Incidental Mutation 'R5776:Nab2'
ID446710
Institutional Source Beutler Lab
Gene Symbol Nab2
Ensembl Gene ENSMUSG00000025402
Gene NameNgfi-A binding protein 2
Synonyms
MMRRC Submission 043375-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5776 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location127660918-127668568 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 127664329 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 298 (Y298F)
Ref Sequence ENSEMBL: ENSMUSP00000096761 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026469] [ENSMUST00000092074] [ENSMUST00000099157] [ENSMUST00000118728] [ENSMUST00000128780] [ENSMUST00000129252]
Predicted Effect possibly damaging
Transcript: ENSMUST00000026469
AA Change: Y298F

PolyPhen 2 Score 0.655 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000026469
Gene: ENSMUSG00000025402
AA Change: Y298F

DomainStartEndE-ValueType
Pfam:NCD1 36 114 1.2e-44 PFAM
Pfam:NCD2 230 364 3.2e-59 PFAM
low complexity region 393 406 N/A INTRINSIC
low complexity region 431 446 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000092074
SMART Domains Protein: ENSMUSP00000089708
Gene: ENSMUSG00000002147

DomainStartEndE-ValueType
STAT_int 2 116 2.76e-31 SMART
Pfam:STAT_bind 273 526 4.4e-87 PFAM
SH2 540 622 1.33e-5 SMART
Pfam:STAT6_C 655 837 1.1e-94 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000099157
AA Change: Y298F

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000096761
Gene: ENSMUSG00000025402
AA Change: Y298F

DomainStartEndE-ValueType
Pfam:NCD1 34 115 4.4e-51 PFAM
Pfam:NCD2 199 366 3.6e-74 PFAM
low complexity region 393 406 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118728
SMART Domains Protein: ENSMUSP00000113473
Gene: ENSMUSG00000040195

DomainStartEndE-ValueType
Pfam:DUF2215 100 348 7.2e-105 PFAM
low complexity region 367 377 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124388
Predicted Effect probably benign
Transcript: ENSMUST00000128780
SMART Domains Protein: ENSMUSP00000121737
Gene: ENSMUSG00000025402

DomainStartEndE-ValueType
Pfam:NCD1 1 66 3.4e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129252
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133270
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133505
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142580
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145470
Meta Mutation Damage Score 0.228 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.3%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the family of NGFI-A binding (NAB) proteins, which function in the nucleus to repress transcription induced by some members of the EGR (early growth response) family of transactivators. NAB proteins can homo- or hetero-multimerize with other EGR or NAB proteins through a conserved N-terminal domain, and repress transcription through two partially redundant C-terminal domains. Transcriptional repression by the encoded protein is mediated in part by interactions with the nucleosome remodeling and deactylase (NuRD) complex. Alternatively spliced transcript variants have been described, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are viable and fertile with normal myelination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass A T 6: 23,107,650 M378K possibly damaging Het
Abca17 A G 17: 24,295,158 V857A probably benign Het
Abca9 C T 11: 110,107,460 probably null Het
Adam22 T C 5: 8,127,361 K583E probably benign Het
Akr1c13 T C 13: 4,194,187 F80L probably damaging Het
Apob A T 12: 8,006,149 I1511F possibly damaging Het
Cfh C A 1: 140,144,023 R291I possibly damaging Het
Col1a1 C T 11: 94,949,724 S1114F unknown Het
Ctsj T C 13: 61,003,142 D168G probably damaging Het
Erf T C 7: 25,246,109 D79G probably damaging Het
Extl1 T C 4: 134,357,772 N629S possibly damaging Het
Fbxo9 T C 9: 78,095,187 E204G probably damaging Het
Fdx1l C A 9: 21,073,482 V9L possibly damaging Het
Gfer G T 17: 24,696,053 S5R probably benign Het
Gm15931 A T 7: 4,281,565 noncoding transcript Het
Gm6309 T A 5: 146,168,881 I158F possibly damaging Het
Gm7247 C T 14: 51,364,348 S26F probably benign Het
Gm8251 T C 1: 44,056,505 E1811G possibly damaging Het
Hacl1 A T 14: 31,622,871 N234K possibly damaging Het
Hcn3 C T 3: 89,148,105 A612T probably benign Het
Hectd1 T A 12: 51,764,114 E1679D possibly damaging Het
Hipk4 T C 7: 27,528,980 L285P probably damaging Het
Igsf3 G A 3: 101,425,480 V25I probably benign Het
Jade1 A G 3: 41,613,792 H765R probably benign Het
Kcnv1 T C 15: 45,114,567 D25G unknown Het
Klhl3 A G 13: 58,005,184 S586P probably benign Het
L3mbtl2 A G 15: 81,684,871 D582G probably damaging Het
Matn2 G A 15: 34,431,619 C835Y probably damaging Het
Mgea5 T C 19: 45,771,924 E265G probably damaging Het
Naa15 A C 3: 51,460,026 D490A probably damaging Het
Nipsnap1 T A 11: 4,888,919 M115K probably benign Het
Nlrp5-ps T C 7: 14,592,724 noncoding transcript Het
Nol4l T G 2: 153,417,821 Q211P probably damaging Het
Olfr427 A T 1: 174,099,773 H105L probably damaging Het
Olfr625-ps1 T A 7: 103,683,039 M97K probably damaging Het
Pkhd1 T C 1: 20,209,185 K2970E possibly damaging Het
Plin4 T C 17: 56,104,983 T683A probably damaging Het
Ppm1g T C 5: 31,205,110 D282G probably benign Het
Ppp6r3 A G 19: 3,526,901 S10P possibly damaging Het
Raph1 G A 1: 60,490,156 probably benign Het
Rc3h2 A G 2: 37,378,313 V935A possibly damaging Het
Reg4 T A 3: 98,233,028 D108E possibly damaging Het
Saraf T A 8: 34,165,450 Y228N probably damaging Het
Sctr T C 1: 120,056,407 S357P probably damaging Het
Sec22b A T 3: 97,914,568 N139Y probably damaging Het
Sgsm1 T A 5: 113,250,957 I1037F probably damaging Het
Skint5 A C 4: 113,763,503 S671R unknown Het
Slc38a3 C A 9: 107,658,749 E62* probably null Het
Slfn14 C T 11: 83,283,599 E189K probably damaging Het
Sox21 A G 14: 118,235,244 L131P probably damaging Het
Stip1 A G 19: 7,022,025 probably null Het
Stx16 G A 2: 174,093,499 G156R probably damaging Het
Susd1 T C 4: 59,315,363 probably benign Het
Tdrd7 T A 4: 46,005,689 D498E probably benign Het
Tln2 C T 9: 67,258,250 E1053K probably damaging Het
Trav6-4 A G 14: 53,454,754 D103G probably damaging Het
Txndc15 A G 13: 55,718,107 E128G probably benign Het
Vmn2r22 A T 6: 123,637,714 W306R probably damaging Het
Yjefn3 A T 8: 69,889,471 L33Q probably damaging Het
Zfp641 T C 15: 98,289,010 D244G probably damaging Het
Other mutations in Nab2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01288:Nab2 APN 10 127665109 missense probably damaging 1.00
IGL01415:Nab2 APN 10 127665103 missense probably damaging 1.00
IGL02248:Nab2 APN 10 127663240 missense probably benign 0.31
IGL03080:Nab2 APN 10 127664794 missense possibly damaging 0.56
IGL03084:Nab2 APN 10 127664477 missense probably damaging 1.00
katie UTSW 10 127664338 missense probably damaging 1.00
R0381:Nab2 UTSW 10 127665067 missense probably damaging 1.00
R1074:Nab2 UTSW 10 127663255 nonsense probably null
R1535:Nab2 UTSW 10 127665047 missense probably damaging 0.99
R4214:Nab2 UTSW 10 127665048 nonsense probably null
R4742:Nab2 UTSW 10 127662827 missense probably benign 0.02
R5590:Nab2 UTSW 10 127664657 missense probably damaging 0.98
R5603:Nab2 UTSW 10 127665121 start codon destroyed probably null 0.96
R6018:Nab2 UTSW 10 127664924 nonsense probably null
R6381:Nab2 UTSW 10 127664351 missense probably damaging 1.00
R6610:Nab2 UTSW 10 127664338 missense probably damaging 1.00
R7025:Nab2 UTSW 10 127666508 intron probably benign
Predicted Primers PCR Primer
(F):5'- TCGTGGGGACAGTCATACAG -3'
(R):5'- CCAGAATCTGATGTTGGAGCAGG -3'

Sequencing Primer
(F):5'- TGGGGACAGTCATACAGAGGTG -3'
(R):5'- CCTGGAACCAGAGATGGTGC -3'
Posted On2016-12-15