Incidental Mutation 'R5778:Rgl1'
ID446791
Institutional Source Beutler Lab
Gene Symbol Rgl1
Ensembl Gene ENSMUSG00000026482
Gene Nameral guanine nucleotide dissociation stimulator,-like 1
SynonymsRgl
MMRRC Submission 043376-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.276) question?
Stock #R5778 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location152516760-152766351 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 152552421 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 315 (H315Q)
Ref Sequence ENSEMBL: ENSMUSP00000107488 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027760] [ENSMUST00000111857] [ENSMUST00000111859]
Predicted Effect probably benign
Transcript: ENSMUST00000027760
AA Change: H317Q

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000027760
Gene: ENSMUSG00000026482
AA Change: H317Q

DomainStartEndE-ValueType
RasGEFN 64 196 5.86e-39 SMART
RasGEF 228 502 9.56e-116 SMART
Blast:RasGEF 522 582 6e-8 BLAST
low complexity region 585 596 N/A INTRINSIC
low complexity region 627 637 N/A INTRINSIC
RA 648 735 1.7e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111857
AA Change: H315Q

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000107488
Gene: ENSMUSG00000026482
AA Change: H315Q

DomainStartEndE-ValueType
RasGEFN 62 194 5.86e-39 SMART
RasGEF 226 500 9.56e-116 SMART
Blast:RasGEF 520 580 7e-8 BLAST
low complexity region 583 594 N/A INTRINSIC
low complexity region 625 635 N/A INTRINSIC
RA 646 733 1.7e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111859
AA Change: H352Q

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000107490
Gene: ENSMUSG00000026482
AA Change: H352Q

DomainStartEndE-ValueType
RasGEFN 99 231 5.86e-39 SMART
RasGEF 263 537 9.56e-116 SMART
Blast:RasGEF 557 617 6e-8 BLAST
low complexity region 620 631 N/A INTRINSIC
low complexity region 662 672 N/A INTRINSIC
RA 683 770 1.7e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188395
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the Ras-like (Ral) -selective guanine nucleotide exchange factor (RalGEF) family of small GTPase activators which function both as downstream effectors of activated Ras GTPase and as regulators of certain Ral GTPases in the RalGEF - Ral GTPase signaling pathway. The encoded protein, like other RalGEFs, has an N-terminal ras exchanger motif domain, a catalytic CDC25 homology domain, and a C-terminal ras binding domain that stimulates guanine nucleotide exchange when bound to a Ral GTPase. RalGEF family members bridge the Ras and Ral signaling pathways and are thought to play a role in oncogenic transformation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A T 3: 36,958,714 I1848F probably damaging Het
Acta1 A G 8: 123,892,125 S340P probably benign Het
Anpep T C 7: 79,836,391 T528A probably benign Het
Apob T A 12: 8,015,074 D4014E probably benign Het
Atp23 A G 10: 126,899,582 C78R probably damaging Het
Atp8b3 A G 10: 80,520,173 F1235S probably benign Het
B3gnt3 T C 8: 71,692,938 D262G probably benign Het
Brca1 G A 11: 101,525,301 A669V possibly damaging Het
Caprin2 A T 6: 148,869,322 S391R probably benign Het
Cdh15 G A 8: 122,856,587 R43Q possibly damaging Het
Celsr1 A T 15: 86,032,955 N272K probably damaging Het
Cryzl2 T G 1: 157,470,787 S249A probably benign Het
Dsg1b A T 18: 20,409,222 T929S possibly damaging Het
Dusp16 G T 6: 134,718,314 T518N probably benign Het
Eno2 A T 6: 124,766,298 H158Q probably damaging Het
Ep400 T C 5: 110,719,584 D954G unknown Het
Erg28 T C 12: 85,819,480 T75A possibly damaging Het
Fam135b T A 15: 71,479,032 T332S probably damaging Het
Fam19a3 T A 3: 104,772,189 K126N probably damaging Het
Fam221b A G 4: 43,660,683 F357L probably damaging Het
Fcgr2b C T 1: 170,963,388 G279R probably damaging Het
Fryl A T 5: 73,072,778 L1679M probably damaging Het
Galm T A 17: 80,127,717 M1K probably null Het
Gsg1 A T 6: 135,244,350 I17N possibly damaging Het
Hif3a A T 7: 17,051,984 I129N probably damaging Het
Ighv1-11 A T 12: 114,612,431 W55R probably damaging Het
Ighv1-20 C A 12: 114,723,877 K82N probably benign Het
Igsf21 C T 4: 140,037,521 E148K probably benign Het
Iltifb C A 10: 118,294,863 E43* probably null Het
Klhdc7b A T 15: 89,387,320 R802W probably damaging Het
Krt8 T C 15: 102,003,939 I101V probably damaging Het
Lrrc7 A G 3: 158,170,743 L570P probably damaging Het
Map4k1 C G 7: 28,994,221 N412K probably benign Het
Metrnl A T 11: 121,714,738 I118F possibly damaging Het
Mmp12 T A 9: 7,350,106 D202E probably damaging Het
Mpp2 A T 11: 102,064,443 S119T probably benign Het
Ncoa6 T C 2: 155,406,768 T1539A probably benign Het
Nlrc5 A G 8: 94,479,526 T715A possibly damaging Het
Nsd1 T A 13: 55,306,979 N1963K probably damaging Het
Nsd3 T C 8: 25,659,818 Y340H probably damaging Het
Nwd1 T A 8: 72,693,117 S977T probably damaging Het
Olfr1167 T A 2: 88,149,617 Y134F probably damaging Het
Olfr77 G T 9: 19,921,041 M277I probably benign Het
Pcdh8 T C 14: 79,770,757 E122G probably damaging Het
Pcmtd2 A C 2: 181,855,198 T323P probably benign Het
Pign C A 1: 105,591,722 G492C probably damaging Het
Plppr3 A G 10: 79,866,503 V245A possibly damaging Het
Prl7a2 C T 13: 27,661,000 W134* probably null Het
Prom1 A T 5: 44,007,047 N722K probably benign Het
Rasal2 A T 1: 157,161,290 N663K probably damaging Het
Smpdl3a C A 10: 57,801,001 A65E probably damaging Het
Spdye4b G A 5: 143,202,387 D212N probably damaging Het
Tanc1 G T 2: 59,699,347 probably null Het
Trio A G 15: 27,856,164 V706A probably benign Het
Tshz1 T A 18: 84,015,680 Q201L probably damaging Het
Ubqln1 C T 13: 58,183,317 M365I probably benign Het
Usp42 A T 5: 143,719,576 Y383N probably damaging Het
Vmn1r189 A G 13: 22,102,382 I95T probably damaging Het
Vmn2r49 A T 7: 9,976,347 S819R probably damaging Het
Other mutations in Rgl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00569:Rgl1 APN 1 152571617 missense probably benign 0.02
IGL01065:Rgl1 APN 1 152519142 missense probably damaging 1.00
IGL01390:Rgl1 APN 1 152571588 splice site probably benign
IGL01726:Rgl1 APN 1 152519153 missense probably damaging 1.00
IGL01837:Rgl1 APN 1 152549150 missense probably damaging 1.00
IGL02019:Rgl1 APN 1 152528469 splice site probably benign
IGL02369:Rgl1 APN 1 152533606 missense probably damaging 1.00
R0240:Rgl1 UTSW 1 152554424 unclassified probably benign
R0255:Rgl1 UTSW 1 152552596 missense probably damaging 1.00
R0562:Rgl1 UTSW 1 152539945 missense probably damaging 1.00
R0648:Rgl1 UTSW 1 152536265 critical splice donor site probably null
R0734:Rgl1 UTSW 1 152554300 missense probably damaging 0.98
R1187:Rgl1 UTSW 1 152544433 missense probably benign 0.14
R1522:Rgl1 UTSW 1 152586533 missense probably damaging 1.00
R1595:Rgl1 UTSW 1 152675023 splice site probably benign
R1634:Rgl1 UTSW 1 152524772 missense probably damaging 1.00
R1661:Rgl1 UTSW 1 152533575 missense probably damaging 0.99
R1665:Rgl1 UTSW 1 152533575 missense probably damaging 0.99
R1964:Rgl1 UTSW 1 152549104 missense probably damaging 1.00
R2291:Rgl1 UTSW 1 152536281 missense probably damaging 1.00
R4272:Rgl1 UTSW 1 152536289 missense probably benign 0.13
R4668:Rgl1 UTSW 1 152521371 missense probably damaging 1.00
R4669:Rgl1 UTSW 1 152521371 missense probably damaging 1.00
R4747:Rgl1 UTSW 1 152524699 nonsense probably null
R4830:Rgl1 UTSW 1 152554330 missense probably benign 0.11
R4853:Rgl1 UTSW 1 152557574 missense probably benign 0.07
R4969:Rgl1 UTSW 1 152549062 splice site probably null
R5979:Rgl1 UTSW 1 152557493 missense probably damaging 1.00
R6180:Rgl1 UTSW 1 152519172 missense probably damaging 1.00
R6183:Rgl1 UTSW 1 152586570 missense possibly damaging 0.94
R6322:Rgl1 UTSW 1 152552435 missense probably damaging 0.98
R6678:Rgl1 UTSW 1 152524724 missense probably damaging 1.00
R6759:Rgl1 UTSW 1 152533530 missense probably damaging 0.99
R6892:Rgl1 UTSW 1 152539940 missense probably benign 0.00
R7290:Rgl1 UTSW 1 152544395 missense possibly damaging 0.78
Z1088:Rgl1 UTSW 1 152675020 start gained probably benign
Predicted Primers PCR Primer
(F):5'- AAGTTAGAGACTGTGCCTTCC -3'
(R):5'- TAAAGCACCCGTGTGTTCCTG -3'

Sequencing Primer
(F):5'- GAGACTGTGCCTTCCTCTACACAAG -3'
(R):5'- AGGTAGTGCCTCACCATTGC -3'
Posted On2016-12-15