Incidental Mutation 'R5778:Fryl'
ID446805
Institutional Source Beutler Lab
Gene Symbol Fryl
Ensembl Gene ENSMUSG00000070733
Gene NameFRY like transcription coactivator
Synonyms2510002A14Rik, 2310004H21Rik, 9030227G01Rik
MMRRC Submission 043376-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.905) question?
Stock #R5778 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location73019987-73256619 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 73072778 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Methionine at position 1679 (L1679M)
Ref Sequence ENSEMBL: ENSMUSP00000098687 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094700] [ENSMUST00000101127]
Predicted Effect probably damaging
Transcript: ENSMUST00000094700
AA Change: L1679M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000092289
Gene: ENSMUSG00000070733
AA Change: L1679M

DomainStartEndE-ValueType
Pfam:MOR2-PAG1_N 117 649 5.7e-176 PFAM
low complexity region 873 884 N/A INTRINSIC
Pfam:MOR2-PAG1_mid 896 1141 1.3e-5 PFAM
Pfam:MOR2-PAG1_mid 1145 1331 2e-19 PFAM
Pfam:MOR2-PAG1_mid 1351 1450 1.2e-5 PFAM
low complexity region 1476 1487 N/A INTRINSIC
low complexity region 1530 1548 N/A INTRINSIC
Pfam:MOR2-PAG1_mid 1590 1660 1.1e-5 PFAM
Pfam:MOR2-PAG1_mid 1725 1866 3.2e-15 PFAM
low complexity region 1973 1984 N/A INTRINSIC
Pfam:MOR2-PAG1_C 2002 2255 9.9e-78 PFAM
low complexity region 2329 2341 N/A INTRINSIC
low complexity region 2473 2482 N/A INTRINSIC
low complexity region 2485 2500 N/A INTRINSIC
low complexity region 2523 2534 N/A INTRINSIC
coiled coil region 2625 2649 N/A INTRINSIC
low complexity region 2827 2841 N/A INTRINSIC
coiled coil region 2854 2893 N/A INTRINSIC
coiled coil region 2963 2989 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000101127
AA Change: L1679M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000098687
Gene: ENSMUSG00000070733
AA Change: L1679M

DomainStartEndE-ValueType
Pfam:MOR2-PAG1_N 116 649 3e-172 PFAM
low complexity region 873 884 N/A INTRINSIC
Pfam:MOR2-PAG1_mid 898 1115 7.8e-6 PFAM
Pfam:MOR2-PAG1_mid 1147 1331 9.5e-19 PFAM
Pfam:MOR2-PAG1_mid 1351 1503 1.1e-5 PFAM
low complexity region 1530 1548 N/A INTRINSIC
Pfam:MOR2-PAG1_mid 1589 1664 6e-6 PFAM
Pfam:MOR2-PAG1_mid 1725 1866 1.6e-14 PFAM
low complexity region 1973 1984 N/A INTRINSIC
Pfam:MOR2-PAG1_C 1998 2260 4.4e-76 PFAM
low complexity region 2329 2341 N/A INTRINSIC
low complexity region 2473 2482 N/A INTRINSIC
low complexity region 2485 2500 N/A INTRINSIC
low complexity region 2523 2534 N/A INTRINSIC
coiled coil region 2625 2649 N/A INTRINSIC
low complexity region 2827 2841 N/A INTRINSIC
coiled coil region 2854 2893 N/A INTRINSIC
coiled coil region 2963 2989 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156661
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175890
Predicted Effect probably benign
Transcript: ENSMUST00000201277
Predicted Effect unknown
Transcript: ENSMUST00000202381
AA Change: L548M
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202413
Predicted Effect probably benign
Transcript: ENSMUST00000202697
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Most mice homozygous for a knock-out allele exhibit postnatal lethality and defects in kidney development; rare survivors display growth retardation, decreased body weight, and premature death associated with chronic hydronephrosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A T 3: 36,958,714 I1848F probably damaging Het
Acta1 A G 8: 123,892,125 S340P probably benign Het
Anpep T C 7: 79,836,391 T528A probably benign Het
Apob T A 12: 8,015,074 D4014E probably benign Het
Atp23 A G 10: 126,899,582 C78R probably damaging Het
Atp8b3 A G 10: 80,520,173 F1235S probably benign Het
B3gnt3 T C 8: 71,692,938 D262G probably benign Het
Brca1 G A 11: 101,525,301 A669V possibly damaging Het
Caprin2 A T 6: 148,869,322 S391R probably benign Het
Cdh15 G A 8: 122,856,587 R43Q possibly damaging Het
Celsr1 A T 15: 86,032,955 N272K probably damaging Het
Cryzl2 T G 1: 157,470,787 S249A probably benign Het
Dsg1b A T 18: 20,409,222 T929S possibly damaging Het
Dusp16 G T 6: 134,718,314 T518N probably benign Het
Eno2 A T 6: 124,766,298 H158Q probably damaging Het
Ep400 T C 5: 110,719,584 D954G unknown Het
Erg28 T C 12: 85,819,480 T75A possibly damaging Het
Fam135b T A 15: 71,479,032 T332S probably damaging Het
Fam19a3 T A 3: 104,772,189 K126N probably damaging Het
Fam221b A G 4: 43,660,683 F357L probably damaging Het
Fcgr2b C T 1: 170,963,388 G279R probably damaging Het
Galm T A 17: 80,127,717 M1K probably null Het
Gsg1 A T 6: 135,244,350 I17N possibly damaging Het
Hif3a A T 7: 17,051,984 I129N probably damaging Het
Ighv1-11 A T 12: 114,612,431 W55R probably damaging Het
Ighv1-20 C A 12: 114,723,877 K82N probably benign Het
Igsf21 C T 4: 140,037,521 E148K probably benign Het
Iltifb C A 10: 118,294,863 E43* probably null Het
Klhdc7b A T 15: 89,387,320 R802W probably damaging Het
Krt8 T C 15: 102,003,939 I101V probably damaging Het
Lrrc7 A G 3: 158,170,743 L570P probably damaging Het
Map4k1 C G 7: 28,994,221 N412K probably benign Het
Metrnl A T 11: 121,714,738 I118F possibly damaging Het
Mmp12 T A 9: 7,350,106 D202E probably damaging Het
Mpp2 A T 11: 102,064,443 S119T probably benign Het
Ncoa6 T C 2: 155,406,768 T1539A probably benign Het
Nlrc5 A G 8: 94,479,526 T715A possibly damaging Het
Nsd1 T A 13: 55,306,979 N1963K probably damaging Het
Nsd3 T C 8: 25,659,818 Y340H probably damaging Het
Nwd1 T A 8: 72,693,117 S977T probably damaging Het
Olfr1167 T A 2: 88,149,617 Y134F probably damaging Het
Olfr77 G T 9: 19,921,041 M277I probably benign Het
Pcdh8 T C 14: 79,770,757 E122G probably damaging Het
Pcmtd2 A C 2: 181,855,198 T323P probably benign Het
Pign C A 1: 105,591,722 G492C probably damaging Het
Plppr3 A G 10: 79,866,503 V245A possibly damaging Het
Prl7a2 C T 13: 27,661,000 W134* probably null Het
Prom1 A T 5: 44,007,047 N722K probably benign Het
Rasal2 A T 1: 157,161,290 N663K probably damaging Het
Rgl1 G T 1: 152,552,421 H315Q probably benign Het
Smpdl3a C A 10: 57,801,001 A65E probably damaging Het
Spdye4b G A 5: 143,202,387 D212N probably damaging Het
Tanc1 G T 2: 59,699,347 probably null Het
Trio A G 15: 27,856,164 V706A probably benign Het
Tshz1 T A 18: 84,015,680 Q201L probably damaging Het
Ubqln1 C T 13: 58,183,317 M365I probably benign Het
Usp42 A T 5: 143,719,576 Y383N probably damaging Het
Vmn1r189 A G 13: 22,102,382 I95T probably damaging Het
Vmn2r49 A T 7: 9,976,347 S819R probably damaging Het
Other mutations in Fryl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00819:Fryl APN 5 73148108 missense possibly damaging 0.92
IGL01518:Fryl APN 5 73086962 missense possibly damaging 0.76
IGL01545:Fryl APN 5 73054597 missense probably damaging 1.00
IGL01646:Fryl APN 5 73022501 critical splice donor site probably null
IGL01938:Fryl APN 5 73122364 missense probably damaging 0.98
IGL01962:Fryl APN 5 73032791 missense possibly damaging 0.62
IGL02064:Fryl APN 5 73124769 unclassified probably benign
IGL02148:Fryl APN 5 73075959 missense probably benign 0.35
IGL02418:Fryl APN 5 73110176 splice site probably benign
IGL02431:Fryl APN 5 73098308 missense probably benign 0.02
IGL02513:Fryl APN 5 73065293 missense probably damaging 1.00
IGL02557:Fryl APN 5 73098393 missense probably damaging 1.00
IGL02625:Fryl APN 5 73069877 intron probably benign
IGL02642:Fryl APN 5 73095466 missense probably benign
IGL02657:Fryl APN 5 73054860 missense probably benign 0.01
IGL02706:Fryl APN 5 73093163 missense probably benign 0.45
IGL03022:Fryl APN 5 73059383 missense possibly damaging 0.82
IGL03144:Fryl APN 5 73101455 missense probably null 0.22
IGL03155:Fryl APN 5 73076695 missense probably benign
IGL03183:Fryl APN 5 73076695 missense probably benign
IGL03275:Fryl APN 5 73148033 missense possibly damaging 0.47
IGL03310:Fryl APN 5 73136316 splice site probably benign
IGL03341:Fryl APN 5 73076695 missense probably benign
IGL03343:Fryl APN 5 73076695 missense probably benign
IGL03350:Fryl APN 5 73133306 missense probably damaging 0.99
IGL03357:Fryl APN 5 73054059 missense probably damaging 1.00
IGL03374:Fryl APN 5 73110281 splice site probably benign
IGL03375:Fryl APN 5 73088449 missense possibly damaging 0.91
R0062:Fryl UTSW 5 73022278 missense probably benign 0.02
R0062:Fryl UTSW 5 73022278 missense probably benign 0.02
R0308:Fryl UTSW 5 73041604 splice site probably benign
R0312:Fryl UTSW 5 73072888 missense probably damaging 1.00
R0415:Fryl UTSW 5 73098414 missense probably damaging 0.99
R0440:Fryl UTSW 5 73086972 missense possibly damaging 0.91
R0446:Fryl UTSW 5 73097417 missense possibly damaging 0.91
R0566:Fryl UTSW 5 73064497 splice site probably benign
R0567:Fryl UTSW 5 73065391 missense possibly damaging 0.50
R0606:Fryl UTSW 5 73124734 missense probably benign 0.15
R0619:Fryl UTSW 5 73068731 missense probably benign 0.22
R0654:Fryl UTSW 5 73083372 missense probably benign 0.17
R0658:Fryl UTSW 5 73065359 missense probably damaging 1.00
R0707:Fryl UTSW 5 73083372 missense probably benign 0.17
R0744:Fryl UTSW 5 73089081 unclassified probably benign
R0745:Fryl UTSW 5 73071126 missense probably damaging 0.96
R0833:Fryl UTSW 5 73089081 unclassified probably benign
R0885:Fryl UTSW 5 73089196 missense probably damaging 0.97
R0894:Fryl UTSW 5 73041332 splice site probably benign
R1076:Fryl UTSW 5 73124673 unclassified probably benign
R1241:Fryl UTSW 5 73064925 splice site probably benign
R1241:Fryl UTSW 5 73110271 missense probably damaging 1.00
R1394:Fryl UTSW 5 73072912 missense probably damaging 1.00
R1395:Fryl UTSW 5 73072912 missense probably damaging 1.00
R1608:Fryl UTSW 5 73074751 nonsense probably null
R1664:Fryl UTSW 5 73059435 missense probably damaging 1.00
R1745:Fryl UTSW 5 73032861 splice site probably benign
R1937:Fryl UTSW 5 73133367 missense probably damaging 1.00
R1969:Fryl UTSW 5 73098266 missense probably benign 0.18
R1993:Fryl UTSW 5 73108493 missense probably damaging 1.00
R1994:Fryl UTSW 5 73108493 missense probably damaging 1.00
R2029:Fryl UTSW 5 73022122 nonsense probably null
R2036:Fryl UTSW 5 73022544 missense probably benign
R2036:Fryl UTSW 5 73107962 critical splice donor site probably null
R2088:Fryl UTSW 5 73065461 missense probably benign 0.02
R2105:Fryl UTSW 5 73122299 missense probably benign
R2106:Fryl UTSW 5 73098331 missense probably damaging 1.00
R2186:Fryl UTSW 5 73064975 missense probably damaging 1.00
R2239:Fryl UTSW 5 73108547 missense probably damaging 0.99
R2256:Fryl UTSW 5 73072844 missense possibly damaging 0.47
R2257:Fryl UTSW 5 73072844 missense possibly damaging 0.47
R2280:Fryl UTSW 5 73041364 missense possibly damaging 0.47
R2281:Fryl UTSW 5 73041364 missense possibly damaging 0.47
R2911:Fryl UTSW 5 73050456 missense probably damaging 0.99
R3019:Fryl UTSW 5 73082850 missense probably benign 0.01
R3416:Fryl UTSW 5 73108074 missense possibly damaging 0.84
R3783:Fryl UTSW 5 73101476 missense probably benign
R3787:Fryl UTSW 5 73101476 missense probably benign
R3837:Fryl UTSW 5 73071265 missense probably benign 0.03
R3969:Fryl UTSW 5 73112423 missense probably damaging 0.97
R4387:Fryl UTSW 5 73086560 missense possibly damaging 0.91
R4502:Fryl UTSW 5 73088397 missense probably damaging 1.00
R4658:Fryl UTSW 5 73081053 missense probably damaging 1.00
R4664:Fryl UTSW 5 73090679 missense possibly damaging 0.80
R4690:Fryl UTSW 5 73100293 missense probably benign
R4700:Fryl UTSW 5 73065538 missense possibly damaging 0.88
R4709:Fryl UTSW 5 73080972 missense probably benign 0.03
R4807:Fryl UTSW 5 73041362 missense probably benign 0.00
R4912:Fryl UTSW 5 73068782 frame shift probably null
R4948:Fryl UTSW 5 73089130 missense probably benign 0.08
R4959:Fryl UTSW 5 73035058 missense probably benign 0.00
R5062:Fryl UTSW 5 73075893 missense possibly damaging 0.89
R5067:Fryl UTSW 5 73057755 missense probably benign 0.13
R5071:Fryl UTSW 5 73074767 missense probably damaging 0.99
R5072:Fryl UTSW 5 73074767 missense probably damaging 0.99
R5073:Fryl UTSW 5 73074767 missense probably damaging 0.99
R5074:Fryl UTSW 5 73074767 missense probably damaging 0.99
R5139:Fryl UTSW 5 73090718 missense probably damaging 1.00
R5172:Fryl UTSW 5 73101673 missense possibly damaging 0.95
R5187:Fryl UTSW 5 73086600 missense possibly damaging 0.95
R5272:Fryl UTSW 5 73065136 nonsense probably null
R5275:Fryl UTSW 5 73112791 missense probably damaging 1.00
R5295:Fryl UTSW 5 73112791 missense probably damaging 1.00
R5344:Fryl UTSW 5 73104774 missense probably damaging 1.00
R5355:Fryl UTSW 5 73073904 missense probably damaging 1.00
R5716:Fryl UTSW 5 73100465 missense probably benign
R5810:Fryl UTSW 5 73090755 missense probably benign 0.06
R5934:Fryl UTSW 5 73090717 missense probably damaging 1.00
R5948:Fryl UTSW 5 73097372 critical splice donor site probably null
R6005:Fryl UTSW 5 73083295 missense probably damaging 1.00
R6026:Fryl UTSW 5 73099997 missense probably benign 0.04
R6045:Fryl UTSW 5 73118551 missense probably damaging 0.99
R6185:Fryl UTSW 5 73112788 missense probably benign 0.43
R6247:Fryl UTSW 5 73065481 missense probably damaging 0.98
R6294:Fryl UTSW 5 73191759 intron probably benign
R6310:Fryl UTSW 5 73191761 intron probably benign
R6429:Fryl UTSW 5 73090751 missense possibly damaging 0.84
R6568:Fryl UTSW 5 73059516 missense probably damaging 1.00
R6636:Fryl UTSW 5 73133312 missense probably benign 0.01
R6664:Fryl UTSW 5 73132481 missense probably damaging 1.00
R6732:Fryl UTSW 5 73054781 missense probably damaging 1.00
R6750:Fryl UTSW 5 73022232 missense probably damaging 1.00
R6805:Fryl UTSW 5 73065094 missense probably benign 0.03
R6823:Fryl UTSW 5 73065217 missense probably damaging 0.99
R6855:Fryl UTSW 5 73059500 missense probably damaging 1.00
R6858:Fryl UTSW 5 73065032 missense probably damaging 1.00
R6868:Fryl UTSW 5 73068803 missense probably damaging 1.00
R6898:Fryl UTSW 5 73022142 missense probably damaging 0.96
R6908:Fryl UTSW 5 73022211 missense probably damaging 1.00
R6958:Fryl UTSW 5 73073929 missense possibly damaging 0.89
R6980:Fryl UTSW 5 73050430 missense probably benign 0.06
R7036:Fryl UTSW 5 73055608 missense probably benign 0.03
R7065:Fryl UTSW 5 73090756 missense probably damaging 0.96
R7097:Fryl UTSW 5 73073908 missense probably benign 0.31
R7171:Fryl UTSW 5 73122310 missense probably damaging 0.97
R7191:Fryl UTSW 5 73072912 missense probably damaging 1.00
R7207:Fryl UTSW 5 73065095 missense probably benign
R7236:Fryl UTSW 5 73108478 missense possibly damaging 0.66
Z1088:Fryl UTSW 5 73090709 missense probably damaging 0.99
Z1088:Fryl UTSW 5 73090738 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCAACGCATTCTTTGGTTG -3'
(R):5'- CACTTCGTCATATGGGTTTTGC -3'

Sequencing Primer
(F):5'- GGTTATGAATGATTCAGACGCTAC -3'
(R):5'- CGTCATATGGGTTTTGCGACAAG -3'
Posted On2016-12-15