Incidental Mutation 'R5778:Caprin2'
ID446812
Institutional Source Beutler Lab
Gene Symbol Caprin2
Ensembl Gene ENSMUSG00000030309
Gene Namecaprin family member 2
SynonymsC1qdc1, Eeg1, RNG140
MMRRC Submission 043376-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5778 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location148842492-148896237 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 148869322 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 391 (S391R)
Ref Sequence ENSEMBL: ENSMUSP00000107195 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072324] [ENSMUST00000111569]
Predicted Effect probably benign
Transcript: ENSMUST00000072324
SMART Domains Protein: ENSMUSP00000072165
Gene: ENSMUSG00000030309

DomainStartEndE-ValueType
coiled coil region 48 125 N/A INTRINSIC
coiled coil region 239 264 N/A INTRINSIC
Pfam:Caprin-1_C 317 618 1.2e-32 PFAM
C1Q 676 812 1.27e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111569
AA Change: S391R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000107195
Gene: ENSMUSG00000030309
AA Change: S391R

DomainStartEndE-ValueType
coiled coil region 48 125 N/A INTRINSIC
coiled coil region 239 264 N/A INTRINSIC
low complexity region 330 344 N/A INTRINSIC
Pfam:Caprin-1_C 536 836 2.9e-106 PFAM
C1Q 895 1031 1.27e-35 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the caprin family. The encoded protein may function as an RNA-binding protein that induces the formation of RNA granules and plays an important role in brain function. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2014]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A T 3: 36,958,714 I1848F probably damaging Het
Acta1 A G 8: 123,892,125 S340P probably benign Het
Anpep T C 7: 79,836,391 T528A probably benign Het
Apob T A 12: 8,015,074 D4014E probably benign Het
Atp23 A G 10: 126,899,582 C78R probably damaging Het
Atp8b3 A G 10: 80,520,173 F1235S probably benign Het
B3gnt3 T C 8: 71,692,938 D262G probably benign Het
Brca1 G A 11: 101,525,301 A669V possibly damaging Het
Cdh15 G A 8: 122,856,587 R43Q possibly damaging Het
Celsr1 A T 15: 86,032,955 N272K probably damaging Het
Cryzl2 T G 1: 157,470,787 S249A probably benign Het
Dsg1b A T 18: 20,409,222 T929S possibly damaging Het
Dusp16 G T 6: 134,718,314 T518N probably benign Het
Eno2 A T 6: 124,766,298 H158Q probably damaging Het
Ep400 T C 5: 110,719,584 D954G unknown Het
Erg28 T C 12: 85,819,480 T75A possibly damaging Het
Fam135b T A 15: 71,479,032 T332S probably damaging Het
Fam19a3 T A 3: 104,772,189 K126N probably damaging Het
Fam221b A G 4: 43,660,683 F357L probably damaging Het
Fcgr2b C T 1: 170,963,388 G279R probably damaging Het
Fryl A T 5: 73,072,778 L1679M probably damaging Het
Galm T A 17: 80,127,717 M1K probably null Het
Gsg1 A T 6: 135,244,350 I17N possibly damaging Het
Hif3a A T 7: 17,051,984 I129N probably damaging Het
Ighv1-11 A T 12: 114,612,431 W55R probably damaging Het
Ighv1-20 C A 12: 114,723,877 K82N probably benign Het
Igsf21 C T 4: 140,037,521 E148K probably benign Het
Iltifb C A 10: 118,294,863 E43* probably null Het
Klhdc7b A T 15: 89,387,320 R802W probably damaging Het
Krt8 T C 15: 102,003,939 I101V probably damaging Het
Lrrc7 A G 3: 158,170,743 L570P probably damaging Het
Map4k1 C G 7: 28,994,221 N412K probably benign Het
Metrnl A T 11: 121,714,738 I118F possibly damaging Het
Mmp12 T A 9: 7,350,106 D202E probably damaging Het
Mpp2 A T 11: 102,064,443 S119T probably benign Het
Ncoa6 T C 2: 155,406,768 T1539A probably benign Het
Nlrc5 A G 8: 94,479,526 T715A possibly damaging Het
Nsd1 T A 13: 55,306,979 N1963K probably damaging Het
Nsd3 T C 8: 25,659,818 Y340H probably damaging Het
Nwd1 T A 8: 72,693,117 S977T probably damaging Het
Olfr1167 T A 2: 88,149,617 Y134F probably damaging Het
Olfr77 G T 9: 19,921,041 M277I probably benign Het
Pcdh8 T C 14: 79,770,757 E122G probably damaging Het
Pcmtd2 A C 2: 181,855,198 T323P probably benign Het
Pign C A 1: 105,591,722 G492C probably damaging Het
Plppr3 A G 10: 79,866,503 V245A possibly damaging Het
Prl7a2 C T 13: 27,661,000 W134* probably null Het
Prom1 A T 5: 44,007,047 N722K probably benign Het
Rasal2 A T 1: 157,161,290 N663K probably damaging Het
Rgl1 G T 1: 152,552,421 H315Q probably benign Het
Smpdl3a C A 10: 57,801,001 A65E probably damaging Het
Spdye4b G A 5: 143,202,387 D212N probably damaging Het
Tanc1 G T 2: 59,699,347 probably null Het
Trio A G 15: 27,856,164 V706A probably benign Het
Tshz1 T A 18: 84,015,680 Q201L probably damaging Het
Ubqln1 C T 13: 58,183,317 M365I probably benign Het
Usp42 A T 5: 143,719,576 Y383N probably damaging Het
Vmn1r189 A G 13: 22,102,382 I95T probably damaging Het
Vmn2r49 A T 7: 9,976,347 S819R probably damaging Het
Other mutations in Caprin2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Caprin2 APN 6 148843071 missense probably damaging 1.00
IGL01364:Caprin2 APN 6 148873028 missense probably benign 0.00
IGL02738:Caprin2 APN 6 148842862 missense probably damaging 1.00
IGL02819:Caprin2 APN 6 148848258 missense probably damaging 0.99
IGL03117:Caprin2 APN 6 148862466 missense possibly damaging 0.91
IGL03123:Caprin2 APN 6 148895007 missense probably damaging 1.00
IGL03378:Caprin2 APN 6 148877854 missense probably benign 0.23
R0242:Caprin2 UTSW 6 148842954 missense probably damaging 1.00
R0242:Caprin2 UTSW 6 148842954 missense probably damaging 1.00
R0621:Caprin2 UTSW 6 148858678 missense possibly damaging 0.94
R0930:Caprin2 UTSW 6 148883511 synonymous probably null
R1540:Caprin2 UTSW 6 148876471 missense probably benign 0.01
R1591:Caprin2 UTSW 6 148873108 missense possibly damaging 0.94
R1763:Caprin2 UTSW 6 148843121 missense probably damaging 1.00
R1885:Caprin2 UTSW 6 148877885 unclassified probably null
R2027:Caprin2 UTSW 6 148877887 missense probably damaging 0.98
R2867:Caprin2 UTSW 6 148846240 synonymous silent
R4856:Caprin2 UTSW 6 148873011 missense probably benign 0.19
R5580:Caprin2 UTSW 6 148858734 missense possibly damaging 0.79
R5696:Caprin2 UTSW 6 148877818 missense possibly damaging 0.49
R5765:Caprin2 UTSW 6 148843168 missense probably damaging 1.00
R5961:Caprin2 UTSW 6 148863540 missense probably damaging 1.00
R6255:Caprin2 UTSW 6 148877892 missense probably benign 0.28
R6440:Caprin2 UTSW 6 148869645 missense probably damaging 1.00
R6997:Caprin2 UTSW 6 148877976 missense probably damaging 1.00
R7034:Caprin2 UTSW 6 148848205 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- CTGAAGCCTGTTCTCTGCAC -3'
(R):5'- AGTCTCCTCAAATGCTGGAATAC -3'

Sequencing Primer
(F):5'- AGCCTGTTCTCTGCACACAGG -3'
(R):5'- ACTTCCAGAGCCAGATGGTCAG -3'
Posted On2016-12-15