Incidental Mutation 'R5778:0610007P14Rik'
List |< first << previous [record 4 of 386652] next >> last >|
ID446839
Institutional Source Beutler Lab
Gene Symbol 0610007P14Rik
Ensembl Gene ENSMUSG00000021252
Gene NameRIKEN cDNA 0610007P14 gene
SynonymsORF11
Accession Numbers
Stock #R5778 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location85815448-85824550 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 85819480 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 75 (T75A)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021676] [ENSMUST00000124311] [ENSMUST00000148323]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021676
AA Change: T75A

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000021676
Gene: ENSMUSG00000021252
AA Change: T75A

DomainStartEndE-ValueType
Pfam:Erg28 6 115 5.9e-43 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124311
AA Change: N948S
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148323
AA Change: T85A
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A T 3: 36,958,714 I1847F probably damaging Het
4933411G11Rik G A 5: 143,202,387 D212N probably damaging Het
Acta1 A G 8: 123,892,125 S340P probably benign Het
Anpep T C 7: 79,836,391 T528A probably benign Het
Apob T A 12: 8,015,074 D4014E probably benign Het
Atp8b3 A G 10: 80,520,173 F1235S probably benign Het
B3gnt3 T C 8: 71,692,938 D262G probably benign Het
BC026585 T G 1: 157,470,787 S249A probably benign Het
Brca1 G A 11: 101,525,301 A669V possibly damaging Het
Caprin2 A T 6: 148,869,322 S391R probably benign Het
Cdh15 G A 8: 122,856,587 R43Q possibly damaging Het
Celsr1 A T 15: 86,032,955 N272K probably damaging Het
Dsg1b A T 18: 20,409,222 T929S possibly damaging Het
Dst C T 1: 34,180,502 H533Y noncoding transcript Het
Dusp16 G T 6: 134,718,314 T518N probably benign Het
Eno2 A T 6: 124,766,298 H158Q probably damaging Het
Ep400 T C 5: 110,719,584 D1027G unknown Het
Fam135a T C 1: 24,067,939 N177D noncoding transcript Het
Fam135b T A 15: 71,479,032 T332S probably damaging Het
Fam19a3 T A 3: 104,772,189 K126N probably damaging Het
Fam221b A G 4: 43,660,683 F357L probably damaging Het
Fcgr2b C T 1: 170,963,388 G279R probably damaging Het
Fryl A T 5: 73,072,778 L1679M probably damaging Het
Galm T A 17: 80,127,717 M1K probably null Het
Glce A G 9: 62,070,630 S71P noncoding transcript Het
Gm1113 A T 9: 35,518,158 S38T noncoding transcript Het
Gm6155 T C 7: 84,834,737 K48R noncoding transcript Het
Gsg1 A T 6: 135,244,350 I17N possibly damaging Het
Hif3a A T 7: 17,051,984 I143N probably damaging Het
Ift20 C A 11: 78,541,040 C155* probably null Het
Ighv1-11 A T 12: 114,612,431 W55R probably damaging Het
Ighv1-20 C A 12: 114,723,877 K82N probably benign Het
Igsf21 C T 4: 140,037,521 E148K probably benign Het
Iltifb C A 10: 118,294,863 E43* probably null Het
Klhdc7b A T 15: 89,387,320 R144W possibly damaging Het
Krt8 T C 15: 102,003,939 I101V probably damaging Het
Lppr3 A G 10: 79,866,503 V245A possibly damaging Het
Lrrc7 A G 3: 158,170,743 L570P probably damaging Het
Map4k1 C G 7: 28,994,221 N458K probably benign Het
Metrnl A T 11: 121,714,738 I200F possibly damaging Het
Mmp12 T A 9: 7,350,106 D202E probably damaging Het
Ncoa6 T C 2: 155,406,768 T1539A probably benign Het
Nf1 T A 11: 79,546,997 L264* probably null Het
Ngrn T C 7: 80,264,381 I239T noncoding transcript Het
Nlrc5 A G 8: 94,479,526 T715A possibly damaging Het
Nsd1 T A 13: 55,306,979 N2066K probably damaging Het
Nwd1 T A 8: 72,693,117 S977T probably damaging Het
Olfr1167 T A 2: 88,149,617 Y134F probably damaging Het
Olfr77 G T 9: 19,921,041 M277I probably benign Het
Pcdh8 T C 14: 79,770,757 E122G probably damaging Het
Pcmtd2 A C 2: 181,855,198 T323P probably benign Het
Pign C A 1: 105,591,722 G492C probably damaging Het
Prl7a2 C T 13: 27,661,000 W134* probably null Het
Prom1 A T 5: 44,007,047 N737K probably benign Het
Rasal2 A T 1: 157,161,290 N663K probably damaging Het
Rccd1 T C 7: 80,318,908 Q583R noncoding transcript Het
Rgl1 G T 1: 152,552,421 H315Q probably benign Het
Smpdl3a C A 10: 57,801,001 A65E probably damaging Het
Tanc1 G T 2: 59,699,347 probably null Het
Trio A G 15: 27,856,164 V706A probably benign Het
Tshz1 T A 18: 84,015,680 Q201L probably damaging Het
Ubqln1 C T 13: 58,183,317 M365I probably benign Het
Usp42 A T 5: 143,719,576 Y383N probably damaging Het
Vmn1r189 A G 13: 22,102,382 I95T probably damaging Het
Vmn2r49 A T 7: 9,976,347 S819R probably damaging Het
Whsc1l1 T C 8: 25,659,818 Y340H probably damaging Het
Other mutations in 0610007P14Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1891:0610007P14Rik UTSW 12 85816188 missense probably benign 0.16
R2304:0610007P14Rik UTSW 12 85816163 missense probably damaging 0.98
R5427:0610007P14Rik UTSW 12 85819567 missense probably damaging 1.00
R5735:0610007P14Rik UTSW 12 85816152 missense probably benign 0.43
Predicted Primers PCR Primer
(F):5'- GAAAGGTGTGCTCTAATCACG -3'
(R):5'- CATCACCAGGGAAGCAGACTAG -3'

Sequencing Primer
(F):5'- CAAGGACAGTGCCGTGCTATTTG -3'
(R):5'- CAGACTAGCATAGGACAAGGCTC -3'
Posted OnDec 15, 2016