Incidental Mutation 'R5779:Traf5'
ID446861
Institutional Source Beutler Lab
Gene Symbol Traf5
Ensembl Gene ENSMUSG00000026637
Gene NameTNF receptor-associated factor 5
Synonyms
MMRRC Submission 043377-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5779 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location191997205-192092559 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 191997672 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 473 (R473W)
Ref Sequence ENSEMBL: ENSMUSP00000082710 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085573]
Predicted Effect probably damaging
Transcript: ENSMUST00000085573
AA Change: R473W

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000082710
Gene: ENSMUSG00000026637
AA Change: R473W

DomainStartEndE-ValueType
RING 45 84 1.74e-4 SMART
Pfam:zf-TRAF 128 183 4.8e-21 PFAM
Pfam:zf-TRAF 183 241 4.2e-19 PFAM
MATH 402 525 2.42e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175262
Predicted Effect unknown
Transcript: ENSMUST00000192628
AA Change: R170W
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194408
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195647
Meta Mutation Damage Score 0.3 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 88% (52/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The scaffold protein encoded by this gene is a member of the tumor necrosis factor receptor-associated factor (TRAF) protein family and contains a meprin and TRAF homology (MATH) domain, a RING-type zinc finger, and two TRAF-type zinc fingers. TRAF proteins are associated with, and mediate signal transduction from members of the TNF receptor superfamily. This protein is one of the components of a multiple protein complex which binds to tumor necrosis factor (TNF) receptor cytoplasmic domains and mediates TNF-induced activation. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous null mice show defects in lymphocyte activation but are otherwise viable and develop normally. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik A T 17: 56,881,061 N190Y probably benign Het
2310035C23Rik T G 1: 105,687,347 N246K probably damaging Het
Abca6 T C 11: 110,184,670 M1332V probably benign Het
Afg3l2 T C 18: 67,440,443 K132R probably null Het
Arap3 T C 18: 37,984,365 D886G probably damaging Het
B3gntl1 G T 11: 121,651,676 probably null Het
Cdk12 T A 11: 98,219,074 S640R probably benign Het
Ceacam12 C A 7: 18,069,154 P162T probably benign Het
Chrna5 C A 9: 54,998,104 H67N probably benign Het
Copb1 T A 7: 114,219,572 D837V probably damaging Het
D11Wsu47e A G 11: 113,687,992 D71G probably benign Het
Dcaf5 C T 12: 80,338,832 R840H probably benign Het
Ect2l T A 10: 18,163,438 Q324L probably benign Het
Eef1e1 T C 13: 38,646,273 N141S probably damaging Het
Eif2ak4 A C 2: 118,412,963 N208T possibly damaging Het
Ext1 A G 15: 53,344,553 Y271H probably damaging Het
Fam173a A G 17: 25,790,657 V194A probably benign Het
Fbxo5 G A 10: 5,800,303 R323C possibly damaging Het
Fpr-rs3 C A 17: 20,624,226 A218S possibly damaging Het
Gm20499 G A 5: 114,817,021 probably benign Het
Gucy1b2 C A 14: 62,414,301 L400F possibly damaging Het
Hgd T A 16: 37,593,371 L24H probably benign Het
Hmx3 C A 7: 131,544,328 S255* probably null Het
Ifrd1 A T 12: 40,203,370 F448I probably damaging Het
Igfn1 T A 1: 135,966,840 E1996V probably benign Het
Itpr1 G A 6: 108,352,143 G173R probably damaging Het
Kbtbd8 T C 6: 95,118,534 S26P probably benign Het
Kctd17 A T 15: 78,437,133 probably benign Het
Matr3 T C 18: 35,584,522 S258P possibly damaging Het
Mpp4 G A 1: 59,151,666 A90V probably benign Het
Mrpl20 G A 4: 155,806,921 R34Q probably damaging Het
Neb A T 2: 52,245,301 S3266T probably damaging Het
Nipal3 A G 4: 135,452,339 probably benign Het
Npas2 A T 1: 39,287,571 T46S possibly damaging Het
Nsd3 G T 8: 25,682,669 E815* probably null Het
Nup98 C A 7: 102,152,361 V786L probably benign Het
Olfr730 A T 14: 50,186,746 M157K possibly damaging Het
Pcdhb3 T C 18: 37,301,467 V162A probably benign Het
Pcgf2 G A 11: 97,690,291 P58L probably damaging Het
Penk A G 4: 4,134,318 F110L probably damaging Het
Scfd1 A G 12: 51,431,529 N508S probably benign Het
Scn2a T C 2: 65,764,483 V1892A probably benign Het
Sema6a G A 18: 47,248,826 R885C probably damaging Het
Sik2 T C 9: 50,895,845 H755R probably benign Het
Slc36a3 A T 11: 55,135,268 Y241* probably null Het
Smg5 T C 3: 88,351,618 probably benign Het
Spag9 A G 11: 94,114,253 T1049A probably benign Het
Tas2r103 T C 6: 133,036,945 M53V probably benign Het
Tpr C T 1: 150,423,541 A1090V probably damaging Het
Ush2a T C 1: 188,443,510 probably null Het
Vit A G 17: 78,546,426 T34A probably benign Het
Other mutations in Traf5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Traf5 APN 1 192057174 missense possibly damaging 0.95
IGL01462:Traf5 APN 1 191999867 missense probably benign
IGL02262:Traf5 APN 1 191997675 missense probably damaging 1.00
IGL02579:Traf5 APN 1 191999887 missense probably damaging 0.99
IGL03308:Traf5 APN 1 191997500 missense probably damaging 0.99
PIT4445001:Traf5 UTSW 1 191997807 missense
R0028:Traf5 UTSW 1 192074121 intron probably benign
R0689:Traf5 UTSW 1 191997876 missense probably benign 0.16
R1511:Traf5 UTSW 1 191999951 missense probably benign 0.01
R1641:Traf5 UTSW 1 191997509 missense probably benign 0.20
R2235:Traf5 UTSW 1 192054391 missense probably damaging 1.00
R2246:Traf5 UTSW 1 192066890 splice site probably null
R2301:Traf5 UTSW 1 191997965 missense probably benign 0.01
R3973:Traf5 UTSW 1 191997876 missense probably benign 0.16
R4396:Traf5 UTSW 1 191997845 missense probably benign 0.22
R4793:Traf5 UTSW 1 191997804 missense probably benign 0.38
R4834:Traf5 UTSW 1 192066898 missense probably benign 0.10
R5795:Traf5 UTSW 1 191999846 missense probably benign 0.00
R5843:Traf5 UTSW 1 191997485 missense possibly damaging 0.55
R5912:Traf5 UTSW 1 191998069 intron probably benign
R5963:Traf5 UTSW 1 192000016 missense probably benign 0.06
R6246:Traf5 UTSW 1 192070553 missense probably damaging 0.99
R6287:Traf5 UTSW 1 191999872 missense probably damaging 1.00
R6455:Traf5 UTSW 1 191999926 missense probably benign 0.00
R7248:Traf5 UTSW 1 192059017 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- TCTTGGAGTTCTCCAGAGTAGAG -3'
(R):5'- AGTGGCAAGCTCATCTGGAAG -3'

Sequencing Primer
(F):5'- TTCTCCAGAGTAGAGTGCGACAC -3'
(R):5'- CAAGCTCATCTGGAAGGTGAC -3'
Posted On2016-12-15