Incidental Mutation 'R0544:Col4a1'
ID44689
Institutional Source Beutler Lab
Gene Symbol Col4a1
Ensembl Gene ENSMUSG00000031502
Gene Namecollagen, type IV, alpha 1
SynonymsDel(8)Bru44H, Svc, Raw, Del(8)44H, Bru, Col4a-1, alpha1(IV) collagen
MMRRC Submission 038736-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0544 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location11198423-11312826 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to G at 11226487 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148226 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033898] [ENSMUST00000209661] [ENSMUST00000209735]
Predicted Effect unknown
Transcript: ENSMUST00000033898
AA Change: I579L
SMART Domains Protein: ENSMUSP00000033898
Gene: ENSMUSG00000031502
AA Change: I579L

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 28 43 N/A INTRINSIC
internal_repeat_2 49 89 2.1e-8 PROSPERO
Pfam:Collagen 103 163 6.1e-11 PFAM
Pfam:Collagen 167 225 7.8e-10 PFAM
low complexity region 232 248 N/A INTRINSIC
Pfam:Collagen 274 334 1.7e-11 PFAM
low complexity region 356 389 N/A INTRINSIC
low complexity region 404 426 N/A INTRINSIC
low complexity region 435 455 N/A INTRINSIC
Pfam:Collagen 472 533 7.3e-12 PFAM
Pfam:Collagen 539 597 4.8e-9 PFAM
low complexity region 600 636 N/A INTRINSIC
Pfam:Collagen 642 689 4.5e-8 PFAM
Pfam:Collagen 689 746 3.5e-8 PFAM
Pfam:Collagen 736 800 2.2e-9 PFAM
Pfam:Collagen 837 896 5.2e-11 PFAM
Pfam:Collagen 882 940 1.9e-10 PFAM
Pfam:Collagen 943 1007 1.7e-10 PFAM
Pfam:Collagen 996 1058 2e-9 PFAM
Pfam:Collagen 1057 1121 1.5e-10 PFAM
low complexity region 1133 1148 N/A INTRINSIC
Pfam:Collagen 1174 1233 8.6e-11 PFAM
low complexity region 1236 1266 N/A INTRINSIC
Pfam:Collagen 1269 1337 1e-8 PFAM
Pfam:Collagen 1290 1354 2.2e-9 PFAM
Pfam:Collagen 1384 1443 1e-10 PFAM
C4 1445 1554 3.49e-65 SMART
C4 1555 1668 1.53e-79 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208386
Predicted Effect probably benign
Transcript: ENSMUST00000209661
Predicted Effect unknown
Transcript: ENSMUST00000209735
AA Change: I579L
Meta Mutation Damage Score 0.0664 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 98% (97/99)
MGI Phenotype FUNCTION: This gene encodes the alpha-1 subunit of the type IV collagens, an essential component of basement membranes. The encoded protein forms a triple helical heterotrimer comprised of two alpha-1 and one alpha-2 subunits that assembles into a type IV collagen network. This gene is located adjacent to the gene encoding alpha-2 subunit. Mice lacking both the alpha-1 and alpha-2 subunits of collagen IV die in utero due to structural deficiencies in the basement membranes and certain mutations in this gene cause perinatal cerebral hemorrhage and porencephaly. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice with ENU induced alleles have various eye and vision defects and may show bruising at birth. Mice carrying the G498V mutation have renal glomerular defects that resolve within the first weeks of life, but show retinal tortuosity, muscular dystrophy, brain hemorrhages, and renal cysts as adults. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930012K11Rik A T 14: 70,157,314 F130L probably benign Het
Aatf C T 11: 84,423,005 R511Q probably benign Het
Acot12 A T 13: 91,784,656 D516V probably benign Het
Adgrb2 T C 4: 130,017,542 V1207A probably damaging Het
Akap9 A G 5: 4,069,185 D3564G probably benign Het
Arl8b C T 6: 108,783,228 probably benign Het
Atf6b T C 17: 34,648,299 probably null Het
Atrn G A 2: 130,986,826 G1097D probably damaging Het
Btbd6 A G 12: 112,977,082 E61G probably damaging Het
Car15 A G 16: 17,835,816 probably benign Het
Car5b G A X: 163,979,301 R282C probably damaging Het
Carmil2 C T 8: 105,691,235 A654V probably damaging Het
Cbwd1 A G 19: 24,949,211 Y159H possibly damaging Het
Ccdc88b A G 19: 6,857,266 L124P probably damaging Het
Ccnd1 A G 7: 144,937,286 probably benign Het
Cd3eap G T 7: 19,359,141 P38Q probably damaging Het
Cenph A G 13: 100,772,741 S53P probably damaging Het
Chrm3 T A 13: 9,877,579 I474F probably damaging Het
Cln8 T A 8: 14,896,769 V261E probably benign Het
Coa6 A G 8: 126,422,760 D25G probably benign Het
Cpxm1 T C 2: 130,393,135 H588R probably damaging Het
Cul7 T C 17: 46,663,544 L1516P possibly damaging Het
Dcdc5 A G 2: 106,351,564 noncoding transcript Het
Ddx5 T C 11: 106,782,462 probably benign Het
Dhx16 C A 17: 35,881,659 P161Q probably benign Het
Dpy19l1 A T 9: 24,485,110 probably benign Het
Fastkd5 A G 2: 130,615,296 V458A probably damaging Het
Fhit A G 14: 9,870,172 V99A probably damaging Het
Fndc3a A T 14: 72,557,622 probably benign Het
Foxd4 A T 19: 24,899,818 S339R possibly damaging Het
Gm10842 T A 11: 105,147,054 D54E unknown Het
Gns T A 10: 121,376,267 Y94* probably null Het
Gp2 A G 7: 119,454,496 W81R probably benign Het
Hdac5 T G 11: 102,196,096 Q46P probably damaging Het
Homer2 A C 7: 81,649,678 V13G probably damaging Het
Irs3 A G 5: 137,643,839 S446P probably benign Het
Ism2 G T 12: 87,285,339 D141E probably damaging Het
Jak1 T A 4: 101,191,625 M19L probably benign Het
Kcnd3 C A 3: 105,658,759 R419S probably damaging Het
Lamb1 T C 12: 31,282,695 F272S probably damaging Het
Ldlrad2 T G 4: 137,572,268 T82P possibly damaging Het
Lrp2 T C 2: 69,491,931 K1885E probably benign Het
Mbd5 T C 2: 49,257,209 V477A possibly damaging Het
Mrps33 A T 6: 39,805,554 M11K possibly damaging Het
Mylk G C 16: 34,879,475 E403Q possibly damaging Het
Myom2 T A 8: 15,069,796 V184E probably damaging Het
Ncor1 C A 11: 62,333,776 G1210V probably damaging Het
Ncor1 C T 11: 62,333,777 G1210R probably damaging Het
Nlrp4a A G 7: 26,457,130 D760G probably benign Het
Noc4l A G 5: 110,651,123 V231A possibly damaging Het
Olfr1056 T C 2: 86,355,663 T240A probably damaging Het
Olfr1217 T C 2: 89,023,826 Y59C probably damaging Het
Olfr1306 A T 2: 111,912,560 Y123* probably null Het
Olfr1450 A G 19: 12,953,702 T38A possibly damaging Het
Olfr193 T A 16: 59,110,225 K128N probably benign Het
Olfr521 T C 7: 99,767,660 I166T probably benign Het
Olfr598 T A 7: 103,328,651 I55N probably damaging Het
Olfr733 A T 14: 50,298,682 V209E probably benign Het
Padi4 GCTGCGTACCTCCAC GC 4: 140,748,449 probably benign Het
Patj T A 4: 98,569,110 M1283K probably damaging Het
Pkd1 C T 17: 24,585,683 T790I probably damaging Het
Plod3 C A 5: 136,991,611 T526K probably benign Het
Plxnb2 C A 15: 89,158,613 probably benign Het
Pramel1 T A 4: 143,397,605 D283E possibly damaging Het
Prpf40a T C 2: 53,141,651 probably benign Het
Psg23 A T 7: 18,614,682 Y67N probably damaging Het
Rftn1 T A 17: 49,994,261 Q242L possibly damaging Het
Rp1l1 A T 14: 64,032,066 E1700D probably benign Het
Scube3 T C 17: 28,164,153 F435S probably damaging Het
Sdk2 T C 11: 113,781,010 Y2104C probably damaging Het
Sept11 A G 5: 93,165,368 E358G possibly damaging Het
Sh3bp1 T C 15: 78,905,775 L246P probably damaging Het
Sis T C 3: 72,951,642 Y352C probably damaging Het
Skint1 T C 4: 112,021,365 S165P probably damaging Het
Skint10 C T 4: 112,728,811 probably benign Het
Slc1a2 A T 2: 102,756,072 R340S probably damaging Het
Slc26a3 C A 12: 31,447,740 Q48K probably benign Het
Slc5a2 A T 7: 128,269,999 Y317F probably damaging Het
Sorbs3 T A 14: 70,193,926 T262S probably benign Het
Tas2r118 G T 6: 23,969,401 S220R probably damaging Het
Terf2ip C A 8: 112,015,342 Q223K possibly damaging Het
Tespa1 A G 10: 130,360,811 Q206R probably damaging Het
Tex10 T C 4: 48,462,766 probably null Het
Tle1 T A 4: 72,124,990 K547N probably damaging Het
Tmem131l T A 3: 83,898,546 Q1530L probably damaging Het
Tomm20l A G 12: 71,123,077 E145G possibly damaging Het
Tra2a C T 6: 49,250,951 probably benign Het
Trim32 G A 4: 65,613,254 R16Q probably damaging Het
Trim37 T A 11: 87,145,502 Y121* probably null Het
Tube1 C T 10: 39,140,945 probably null Het
Usp6nl T A 2: 6,421,009 V187D probably damaging Het
Vmn1r13 T C 6: 57,210,263 F136L probably benign Het
Vmn1r201 A T 13: 22,475,146 I177F probably benign Het
Vmn1r203 A T 13: 22,524,273 T75S possibly damaging Het
Vmn1r225 C T 17: 20,502,456 S53L probably benign Het
Xab2 A T 8: 3,610,994 W707R probably damaging Het
Zfp808 T C 13: 62,169,434 probably benign Het
Other mutations in Col4a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Col4a1 APN 8 11240077 splice site probably benign
IGL00503:Col4a1 APN 8 11240076 splice site probably benign
IGL00938:Col4a1 APN 8 11236456 intron probably benign
IGL01295:Col4a1 APN 8 11236075 intron probably benign
IGL01406:Col4a1 APN 8 11218898 missense probably damaging 1.00
IGL01807:Col4a1 APN 8 11247056 utr 5 prime probably benign
IGL01865:Col4a1 APN 8 11201790 utr 3 prime probably benign
IGL02166:Col4a1 APN 8 11244509 unclassified probably benign
IGL02234:Col4a1 APN 8 11216713 missense probably damaging 1.00
IGL02445:Col4a1 APN 8 11233911 intron probably benign
IGL02719:Col4a1 APN 8 11231950 intron probably benign
IGL02817:Col4a1 APN 8 11220259 missense probably damaging 1.00
IGL02821:Col4a1 APN 8 11221375 missense probably benign 0.04
IGL02870:Col4a1 APN 8 11221375 missense probably benign 0.04
IGL02935:Col4a1 APN 8 11219166 missense probably damaging 1.00
IGL03085:Col4a1 APN 8 11222198 nonsense probably null
Wayne UTSW 8 11209650 missense probably damaging 1.00
IGL03134:Col4a1 UTSW 8 11240069 critical splice acceptor site probably null
R0076:Col4a1 UTSW 8 11218713 missense probably damaging 1.00
R0076:Col4a1 UTSW 8 11218713 missense probably damaging 1.00
R0238:Col4a1 UTSW 8 11218780 splice site probably benign
R0239:Col4a1 UTSW 8 11218780 splice site probably benign
R0268:Col4a1 UTSW 8 11267588 splice site probably benign
R0320:Col4a1 UTSW 8 11242782 splice site probably null
R0402:Col4a1 UTSW 8 11199838 utr 3 prime probably benign
R0483:Col4a1 UTSW 8 11236423 splice site probably benign
R0511:Col4a1 UTSW 8 11208333 critical splice acceptor site probably null
R0630:Col4a1 UTSW 8 11199889 splice site probably benign
R0648:Col4a1 UTSW 8 11246892 missense unknown
R0733:Col4a1 UTSW 8 11218934 missense possibly damaging 0.46
R0839:Col4a1 UTSW 8 11221015 missense probably damaging 0.96
R0900:Col4a1 UTSW 8 11218014 small deletion probably benign
R0941:Col4a1 UTSW 8 11208296 missense unknown
R1456:Col4a1 UTSW 8 11242829 splice site probably benign
R1728:Col4a1 UTSW 8 11212712 missense possibly damaging 0.81
R1832:Col4a1 UTSW 8 11214644 splice site probably benign
R1862:Col4a1 UTSW 8 11226439 intron probably benign
R1955:Col4a1 UTSW 8 11208228 splice site probably null
R2058:Col4a1 UTSW 8 11210792 missense probably damaging 0.96
R2263:Col4a1 UTSW 8 11312586 unclassified probably benign
R2696:Col4a1 UTSW 8 11235092 splice site probably null
R3826:Col4a1 UTSW 8 11209650 missense probably damaging 1.00
R3828:Col4a1 UTSW 8 11209650 missense probably damaging 1.00
R3829:Col4a1 UTSW 8 11209650 missense probably damaging 1.00
R3830:Col4a1 UTSW 8 11209650 missense probably damaging 1.00
R3923:Col4a1 UTSW 8 11201665 utr 3 prime probably benign
R3980:Col4a1 UTSW 8 11239155 intron probably benign
R4120:Col4a1 UTSW 8 11206263 missense unknown
R4152:Col4a1 UTSW 8 11217227 intron probably null
R4437:Col4a1 UTSW 8 11206387 nonsense probably null
R5237:Col4a1 UTSW 8 11245068 unclassified probably benign
R5362:Col4a1 UTSW 8 11245760 unclassified probably benign
R5488:Col4a1 UTSW 8 11312550 unclassified probably benign
R5489:Col4a1 UTSW 8 11312550 unclassified probably benign
R5864:Col4a1 UTSW 8 11202973 utr 3 prime probably benign
R5929:Col4a1 UTSW 8 11216788 missense probably benign 0.17
R6159:Col4a1 UTSW 8 11220007 missense probably damaging 1.00
R6261:Col4a1 UTSW 8 11207409 splice site probably null
R6404:Col4a1 UTSW 8 11207409 splice site probably null
R6520:Col4a1 UTSW 8 11219152 missense probably damaging 1.00
R6862:Col4a1 UTSW 8 11202926 utr 3 prime probably benign
R6974:Col4a1 UTSW 8 11312538 unclassified probably benign
Z1088:Col4a1 UTSW 8 11246859 splice site probably benign
Predicted Primers PCR Primer
(F):5'- ACTTAGCCGATCTGTGGTCTCTGTG -3'
(R):5'- CTGTGACAACTGCTTGGGAGAAGG -3'

Sequencing Primer
(F):5'- TGAAACACTGTGTACCCTGG -3'
(R):5'- GCTTGGGAGAAGGATGCTG -3'
Posted On2013-06-11