Incidental Mutation 'R5779:Dcaf5'
ID446891
Institutional Source Beutler Lab
Gene Symbol Dcaf5
Ensembl Gene ENSMUSG00000049106
Gene NameDDB1 and CUL4 associated factor 5
SynonymsWdr22, 9430020B07Rik, BCRG2, BCRP2
MMRRC Submission 043377-MU
Accession Numbers

Genbank: NM_177267; MGI: 2444785

Is this an essential gene? Possibly non essential (E-score: 0.494) question?
Stock #R5779 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location80335848-80436601 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 80338832 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 840 (R840H)
Ref Sequence ENSEMBL: ENSMUSP00000052755 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054145]
Predicted Effect probably benign
Transcript: ENSMUST00000054145
AA Change: R840H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000052755
Gene: ENSMUSG00000049106
AA Change: R840H

DomainStartEndE-ValueType
WD40 42 82 3.32e-5 SMART
WD40 90 129 1.95e-2 SMART
WD40 132 171 1.28e-6 SMART
WD40 179 216 2.65e1 SMART
low complexity region 248 255 N/A INTRINSIC
WD40 264 308 1.66e0 SMART
WD40 322 361 2.01e-4 SMART
low complexity region 431 441 N/A INTRINSIC
low complexity region 506 518 N/A INTRINSIC
low complexity region 548 573 N/A INTRINSIC
low complexity region 623 638 N/A INTRINSIC
low complexity region 793 807 N/A INTRINSIC
low complexity region 929 941 N/A INTRINSIC
Meta Mutation Damage Score 0.076 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 88% (52/59)
Allele List at MGI

All alleles(3) : Targeted, other(2) Gene trapped(1)

Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik A T 17: 56,881,061 N190Y probably benign Het
2310035C23Rik T G 1: 105,687,347 N246K probably damaging Het
Abca6 T C 11: 110,184,670 M1332V probably benign Het
Afg3l2 T C 18: 67,440,443 K132R probably null Het
Arap3 T C 18: 37,984,365 D886G probably damaging Het
B3gntl1 G T 11: 121,651,676 probably null Het
Cdk12 T A 11: 98,219,074 S640R probably benign Het
Ceacam12 C A 7: 18,069,154 P162T probably benign Het
Chrna5 C A 9: 54,998,104 H67N probably benign Het
Copb1 T A 7: 114,219,572 D837V probably damaging Het
D11Wsu47e A G 11: 113,687,992 D71G probably benign Het
Ect2l T A 10: 18,163,438 Q324L probably benign Het
Eef1e1 T C 13: 38,646,273 N141S probably damaging Het
Eif2ak4 A C 2: 118,412,963 N208T possibly damaging Het
Ext1 A G 15: 53,344,553 Y271H probably damaging Het
Fam173a A G 17: 25,790,657 V194A probably benign Het
Fbxo5 G A 10: 5,800,303 R323C possibly damaging Het
Fpr-rs3 C A 17: 20,624,226 A218S possibly damaging Het
Gm20499 G A 5: 114,817,021 probably benign Het
Gucy1b2 C A 14: 62,414,301 L400F possibly damaging Het
Hgd T A 16: 37,593,371 L24H probably benign Het
Hmx3 C A 7: 131,544,328 S255* probably null Het
Ifrd1 A T 12: 40,203,370 F448I probably damaging Het
Igfn1 T A 1: 135,966,840 E1996V probably benign Het
Itpr1 G A 6: 108,352,143 G173R probably damaging Het
Kbtbd8 T C 6: 95,118,534 S26P probably benign Het
Kctd17 A T 15: 78,437,133 probably benign Het
Matr3 T C 18: 35,584,522 S258P possibly damaging Het
Mpp4 G A 1: 59,151,666 A90V probably benign Het
Mrpl20 G A 4: 155,806,921 R34Q probably damaging Het
Neb A T 2: 52,245,301 S3266T probably damaging Het
Nipal3 A G 4: 135,452,339 probably benign Het
Npas2 A T 1: 39,287,571 T46S possibly damaging Het
Nsd3 G T 8: 25,682,669 E815* probably null Het
Nup98 C A 7: 102,152,361 V786L probably benign Het
Olfr730 A T 14: 50,186,746 M157K possibly damaging Het
Pcdhb3 T C 18: 37,301,467 V162A probably benign Het
Pcgf2 G A 11: 97,690,291 P58L probably damaging Het
Penk A G 4: 4,134,318 F110L probably damaging Het
Scfd1 A G 12: 51,431,529 N508S probably benign Het
Scn2a T C 2: 65,764,483 V1892A probably benign Het
Sema6a G A 18: 47,248,826 R885C probably damaging Het
Sik2 T C 9: 50,895,845 H755R probably benign Het
Slc36a3 A T 11: 55,135,268 Y241* probably null Het
Smg5 T C 3: 88,351,618 probably benign Het
Spag9 A G 11: 94,114,253 T1049A probably benign Het
Tas2r103 T C 6: 133,036,945 M53V probably benign Het
Tpr C T 1: 150,423,541 A1090V probably damaging Het
Traf5 T A 1: 191,997,672 R473W probably damaging Het
Ush2a T C 1: 188,443,510 probably null Het
Vit A G 17: 78,546,426 T34A probably benign Het
Other mutations in Dcaf5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Dcaf5 APN 12 80339323 missense probably benign 0.01
IGL00990:Dcaf5 APN 12 80338832 missense probably benign
IGL01788:Dcaf5 APN 12 80348324 missense probably damaging 1.00
IGL01865:Dcaf5 APN 12 80339314 missense probably benign 0.36
IGL02365:Dcaf5 APN 12 80398773 missense probably benign 0.01
R1160:Dcaf5 UTSW 12 80340215 missense possibly damaging 0.83
R1443:Dcaf5 UTSW 12 80364069 missense probably damaging 1.00
R1804:Dcaf5 UTSW 12 80339829 missense probably benign 0.19
R1945:Dcaf5 UTSW 12 80338694 missense probably benign 0.12
R2043:Dcaf5 UTSW 12 80340217 missense probably benign 0.03
R2104:Dcaf5 UTSW 12 80338861 missense probably benign 0.00
R4831:Dcaf5 UTSW 12 80339084 missense probably benign 0.00
R4860:Dcaf5 UTSW 12 80340232 missense probably benign 0.06
R4860:Dcaf5 UTSW 12 80340232 missense probably benign 0.06
R5257:Dcaf5 UTSW 12 80397719 missense probably damaging 1.00
R5263:Dcaf5 UTSW 12 80348346 missense probably damaging 1.00
R5569:Dcaf5 UTSW 12 80340201 missense probably damaging 1.00
R5597:Dcaf5 UTSW 12 80340043 missense probably damaging 0.99
R5632:Dcaf5 UTSW 12 80397752 missense probably damaging 0.98
R5833:Dcaf5 UTSW 12 80348429 missense probably damaging 0.98
R6794:Dcaf5 UTSW 12 80398893 missense possibly damaging 0.66
R7188:Dcaf5 UTSW 12 80399958 missense probably damaging 1.00
R7238:Dcaf5 UTSW 12 80338709 missense probably benign 0.27
R7286:Dcaf5 UTSW 12 80348390 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACAACCTTGCTGCTGTCCAG -3'
(R):5'- TCAATGGAAAGGCTCTGAGC -3'

Sequencing Primer
(F):5'- TGCTGTCCAGGCCTGAAG -3'
(R):5'- TCTGAGCAAGGCCCTGAG -3'
Posted On2016-12-15