Incidental Mutation 'R0544:Cln8'
ID44690
Institutional Source Beutler Lab
Gene Symbol Cln8
Ensembl Gene ENSMUSG00000026317
Gene Nameceroid-lipofuscinosis, neuronal 8
Synonyms
MMRRC Submission 038736-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.288) question?
Stock #R0544 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location14881335-14901720 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 14896769 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 261 (V261E)
Ref Sequence ENSEMBL: ENSMUSP00000027554 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027554] [ENSMUST00000123990] [ENSMUST00000128839] [ENSMUST00000132001] [ENSMUST00000133578]
Predicted Effect probably benign
Transcript: ENSMUST00000027554
AA Change: V261E

PolyPhen 2 Score 0.322 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000027554
Gene: ENSMUSG00000026317
AA Change: V261E

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
TLC 62 262 3.4e-37 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123990
SMART Domains Protein: ENSMUSP00000119031
Gene: ENSMUSG00000026317

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Blast:TLC 62 124 6e-38 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000128839
SMART Domains Protein: ENSMUSP00000121618
Gene: ENSMUSG00000026317

DomainStartEndE-ValueType
transmembrane domain 27 49 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132001
Predicted Effect probably benign
Transcript: ENSMUST00000133578
Meta Mutation Damage Score 0.282 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 98% (97/99)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein belonging to a family of proteins containing TLC domains, which are postulated to function in lipid synthesis, transport, or sensing. The protein localizes to the endoplasmic reticulum (ER), and may recycle between the ER and ER-Golgi intermediate compartment. Mutations in this gene are associated with progressive epilepsy with mental retardation (EMPR), which is a subtype of neuronal ceroid lipofuscinoses (NCL). Patients with mutations in this gene have altered levels of sphingolipid and phospholipids in the brain. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants exhibit late-onset progressive motor neuron degeneration and retinal photoreceptor degeneration. Mutants accumulate proteolipid in neuronal cytoplasm, have hindlimb weakness and ataxia, and die at 9-14 months of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930012K11Rik A T 14: 70,157,314 F130L probably benign Het
Aatf C T 11: 84,423,005 R511Q probably benign Het
Acot12 A T 13: 91,784,656 D516V probably benign Het
Adgrb2 T C 4: 130,017,542 V1207A probably damaging Het
Akap9 A G 5: 4,069,185 D3564G probably benign Het
Arl8b C T 6: 108,783,228 probably benign Het
Atf6b T C 17: 34,648,299 probably null Het
Atrn G A 2: 130,986,826 G1097D probably damaging Het
Btbd6 A G 12: 112,977,082 E61G probably damaging Het
Car15 A G 16: 17,835,816 probably benign Het
Car5b G A X: 163,979,301 R282C probably damaging Het
Carmil2 C T 8: 105,691,235 A654V probably damaging Het
Cbwd1 A G 19: 24,949,211 Y159H possibly damaging Het
Ccdc88b A G 19: 6,857,266 L124P probably damaging Het
Ccnd1 A G 7: 144,937,286 probably benign Het
Cd3eap G T 7: 19,359,141 P38Q probably damaging Het
Cenph A G 13: 100,772,741 S53P probably damaging Het
Chrm3 T A 13: 9,877,579 I474F probably damaging Het
Coa6 A G 8: 126,422,760 D25G probably benign Het
Col4a1 T G 8: 11,226,487 probably benign Het
Cpxm1 T C 2: 130,393,135 H588R probably damaging Het
Cul7 T C 17: 46,663,544 L1516P possibly damaging Het
Dcdc5 A G 2: 106,351,564 noncoding transcript Het
Ddx5 T C 11: 106,782,462 probably benign Het
Dhx16 C A 17: 35,881,659 P161Q probably benign Het
Dpy19l1 A T 9: 24,485,110 probably benign Het
Fastkd5 A G 2: 130,615,296 V458A probably damaging Het
Fhit A G 14: 9,870,172 V99A probably damaging Het
Fndc3a A T 14: 72,557,622 probably benign Het
Foxd4 A T 19: 24,899,818 S339R possibly damaging Het
Gm10842 T A 11: 105,147,054 D54E unknown Het
Gns T A 10: 121,376,267 Y94* probably null Het
Gp2 A G 7: 119,454,496 W81R probably benign Het
Hdac5 T G 11: 102,196,096 Q46P probably damaging Het
Homer2 A C 7: 81,649,678 V13G probably damaging Het
Irs3 A G 5: 137,643,839 S446P probably benign Het
Ism2 G T 12: 87,285,339 D141E probably damaging Het
Jak1 T A 4: 101,191,625 M19L probably benign Het
Kcnd3 C A 3: 105,658,759 R419S probably damaging Het
Lamb1 T C 12: 31,282,695 F272S probably damaging Het
Ldlrad2 T G 4: 137,572,268 T82P possibly damaging Het
Lrp2 T C 2: 69,491,931 K1885E probably benign Het
Mbd5 T C 2: 49,257,209 V477A possibly damaging Het
Mrps33 A T 6: 39,805,554 M11K possibly damaging Het
Mylk G C 16: 34,879,475 E403Q possibly damaging Het
Myom2 T A 8: 15,069,796 V184E probably damaging Het
Ncor1 C A 11: 62,333,776 G1210V probably damaging Het
Ncor1 C T 11: 62,333,777 G1210R probably damaging Het
Nlrp4a A G 7: 26,457,130 D760G probably benign Het
Noc4l A G 5: 110,651,123 V231A possibly damaging Het
Olfr1056 T C 2: 86,355,663 T240A probably damaging Het
Olfr1217 T C 2: 89,023,826 Y59C probably damaging Het
Olfr1306 A T 2: 111,912,560 Y123* probably null Het
Olfr1450 A G 19: 12,953,702 T38A possibly damaging Het
Olfr193 T A 16: 59,110,225 K128N probably benign Het
Olfr521 T C 7: 99,767,660 I166T probably benign Het
Olfr598 T A 7: 103,328,651 I55N probably damaging Het
Olfr733 A T 14: 50,298,682 V209E probably benign Het
Padi4 GCTGCGTACCTCCAC GC 4: 140,748,449 probably benign Het
Patj T A 4: 98,569,110 M1283K probably damaging Het
Pkd1 C T 17: 24,585,683 T790I probably damaging Het
Plod3 C A 5: 136,991,611 T526K probably benign Het
Plxnb2 C A 15: 89,158,613 probably benign Het
Pramel1 T A 4: 143,397,605 D283E possibly damaging Het
Prpf40a T C 2: 53,141,651 probably benign Het
Psg23 A T 7: 18,614,682 Y67N probably damaging Het
Rftn1 T A 17: 49,994,261 Q242L possibly damaging Het
Rp1l1 A T 14: 64,032,066 E1700D probably benign Het
Scube3 T C 17: 28,164,153 F435S probably damaging Het
Sdk2 T C 11: 113,781,010 Y2104C probably damaging Het
Sept11 A G 5: 93,165,368 E358G possibly damaging Het
Sh3bp1 T C 15: 78,905,775 L246P probably damaging Het
Sis T C 3: 72,951,642 Y352C probably damaging Het
Skint1 T C 4: 112,021,365 S165P probably damaging Het
Skint10 C T 4: 112,728,811 probably benign Het
Slc1a2 A T 2: 102,756,072 R340S probably damaging Het
Slc26a3 C A 12: 31,447,740 Q48K probably benign Het
Slc5a2 A T 7: 128,269,999 Y317F probably damaging Het
Sorbs3 T A 14: 70,193,926 T262S probably benign Het
Tas2r118 G T 6: 23,969,401 S220R probably damaging Het
Terf2ip C A 8: 112,015,342 Q223K possibly damaging Het
Tespa1 A G 10: 130,360,811 Q206R probably damaging Het
Tex10 T C 4: 48,462,766 probably null Het
Tle1 T A 4: 72,124,990 K547N probably damaging Het
Tmem131l T A 3: 83,898,546 Q1530L probably damaging Het
Tomm20l A G 12: 71,123,077 E145G possibly damaging Het
Tra2a C T 6: 49,250,951 probably benign Het
Trim32 G A 4: 65,613,254 R16Q probably damaging Het
Trim37 T A 11: 87,145,502 Y121* probably null Het
Tube1 C T 10: 39,140,945 probably null Het
Usp6nl T A 2: 6,421,009 V187D probably damaging Het
Vmn1r13 T C 6: 57,210,263 F136L probably benign Het
Vmn1r201 A T 13: 22,475,146 I177F probably benign Het
Vmn1r203 A T 13: 22,524,273 T75S possibly damaging Het
Vmn1r225 C T 17: 20,502,456 S53L probably benign Het
Xab2 A T 8: 3,610,994 W707R probably damaging Het
Zfp808 T C 13: 62,169,434 probably benign Het
Other mutations in Cln8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Cln8 APN 8 14896637 missense probably benign 0.00
IGL00791:Cln8 APN 8 14894689 start codon destroyed probably null 0.99
IGL02340:Cln8 APN 8 14895178 missense probably damaging 1.00
IGL03037:Cln8 APN 8 14894679 utr 5 prime probably benign
IGL03213:Cln8 APN 8 14894845 missense probably damaging 1.00
R4184:Cln8 UTSW 8 14895030 missense probably benign 0.01
R4634:Cln8 UTSW 8 14894842 missense probably damaging 1.00
R4925:Cln8 UTSW 8 14895004 missense possibly damaging 0.81
R5930:Cln8 UTSW 8 14896621 missense probably damaging 1.00
R6185:Cln8 UTSW 8 14896544 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AGGCCAACCAGTGGCTAATGATCC -3'
(R):5'- ATGGCAAAGACCTCTTCCAGGCAC -3'

Sequencing Primer
(F):5'- CAGTGGCTAATGATCCACATGTTTC -3'
(R):5'- CCAGCAATACTTCATGGGTACTTTAG -3'
Posted On2013-06-11