Incidental Mutation 'R5780:Sema3f'
ID446941
Institutional Source Beutler Lab
Gene Symbol Sema3f
Ensembl Gene ENSMUSG00000034684
Gene Namesema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3F
SynonymsSema IV, Semak
MMRRC Submission 043205-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5780 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location107681500-107710475 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 107682589 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 702 (L702P)
Ref Sequence ENSEMBL: ENSMUSP00000079400 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010205] [ENSMUST00000080560] [ENSMUST00000192271] [ENSMUST00000192727] [ENSMUST00000194039]
Predicted Effect probably benign
Transcript: ENSMUST00000010205
SMART Domains Protein: ENSMUSP00000010205
Gene: ENSMUSG00000034837

DomainStartEndE-ValueType
G_alpha 9 349 5.13e-223 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000080560
AA Change: L702P

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000079400
Gene: ENSMUSG00000034684
AA Change: L702P

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Sema 57 498 5.46e-206 SMART
PSI 516 568 1.87e-12 SMART
IGc2 586 654 3.79e-4 SMART
low complexity region 673 695 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192157
Predicted Effect probably benign
Transcript: ENSMUST00000192271
SMART Domains Protein: ENSMUSP00000141571
Gene: ENSMUSG00000034837

DomainStartEndE-ValueType
low complexity region 14 27 N/A INTRINSIC
transmembrane domain 32 49 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000192727
AA Change: L733P

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000141865
Gene: ENSMUSG00000034684
AA Change: L733P

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Sema 57 529 3.31e-205 SMART
PSI 547 599 1.87e-12 SMART
IGc2 617 685 3.79e-4 SMART
low complexity region 704 726 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193188
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193665
Predicted Effect probably benign
Transcript: ENSMUST00000194039
SMART Domains Protein: ENSMUSP00000142221
Gene: ENSMUSG00000034684

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Sema 57 185 2e-42 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194146
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194153
Predicted Effect probably benign
Transcript: ENSMUST00000194424
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194802
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194846
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195129
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195267
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the semaphorin III family of secreted signaling proteins that are involved in axon guidance during neuronal development. The encoded protein contains an N-terminal Sema domain, an immunoglobulin loop and a C-terminal basic domain. This gene is expressed by the endothelial cells where it was found to act in an autocrine fashion to induce apoptosis, inhibit cell proliferation and survival, and function as an anti-tumorigenic agent. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2016]
PHENOTYPE: Inactivation of this locus results in neuronal defects including impaired CNS axon pathfinding, and PNS and limbic system circuitry. Mice homozygous for a knock-out allele exhibit increased lymphatic branching complexity and LEC numbers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630001G21Rik C T 1: 85,718,318 A189T probably benign Het
Acsm4 A G 7: 119,693,845 E66G possibly damaging Het
Afm A G 5: 90,551,431 E578G possibly damaging Het
Alox5 A T 6: 116,420,349 D291E probably benign Het
Apoa4 A G 9: 46,242,592 M164V possibly damaging Het
Atp6v1a A T 16: 44,114,643 M61K probably benign Het
Avp A G 2: 130,580,709 S159P probably benign Het
Bicra A T 7: 15,979,754 L841Q possibly damaging Het
Cdk5rap1 CTT CT 2: 154,345,868 probably null Het
Clasp2 T G 9: 113,850,152 L246R probably damaging Het
Dhdds G A 4: 133,996,830 L58F probably damaging Het
Dmkn A G 7: 30,777,615 D227G probably damaging Het
Dnah7a G A 1: 53,483,319 A2920V probably benign Het
Epb41l1 C T 2: 156,496,525 R163W probably damaging Het
Etfbkmt T A 6: 149,147,159 Y99N probably damaging Het
Fat4 T C 3: 38,980,955 Y2919H probably damaging Het
Fcgbp T A 7: 28,085,218 D234E probably benign Het
Frem1 T C 4: 82,950,415 D1443G probably benign Het
Fscn2 A C 11: 120,366,668 E285A probably benign Het
Gm12794 C T 4: 101,941,527 L232F probably damaging Het
Gm14124 T A 2: 150,266,219 M33K probably benign Het
Hmga2 T A 10: 120,462,678 R79* probably null Het
Hrh3 A T 2: 180,100,815 V308E probably damaging Het
Hsd11b2 G A 8: 105,522,155 G93D probably damaging Het
Hydin T C 8: 110,586,080 F4151S probably damaging Het
Ica1l C A 1: 60,028,215 E5D probably benign Het
Kcnma1 C A 14: 23,386,351 E640* probably null Het
Mdn1 C T 4: 32,722,950 H2422Y probably benign Het
Mgarp T C 3: 51,391,848 T47A probably damaging Het
Mmp13 T G 9: 7,278,952 F348V possibly damaging Het
Mov10l1 A G 15: 89,011,978 D675G probably benign Het
Nxpe3 T A 16: 55,866,441 Q68L probably damaging Het
Olfr1287 A T 2: 111,449,833 D231V probably benign Het
Olfr784 T C 10: 129,388,070 S146P probably damaging Het
Olfr869 T A 9: 20,137,497 M127K probably damaging Het
Pald1 A T 10: 61,339,218 I751N probably damaging Het
Prickle2 T C 6: 92,458,612 T3A probably benign Het
Ros1 A T 10: 52,194,857 C34S probably damaging Het
Soga1 A G 2: 157,018,490 C1610R probably damaging Het
Sptbn2 T A 19: 4,724,667 L116Q probably damaging Het
Stard9 T C 2: 120,703,396 V3378A probably benign Het
Sycp2l A G 13: 41,129,500 I158V possibly damaging Het
Tbc1d10b G A 7: 127,198,753 R739W possibly damaging Het
Tnik T C 3: 28,594,092 M431T probably benign Het
Ube4b C T 4: 149,331,364 R1091Q probably benign Het
Vwce C A 19: 10,650,619 P481Q probably damaging Het
Other mutations in Sema3f
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00945:Sema3f APN 9 107685522 missense probably benign 0.44
IGL01940:Sema3f APN 9 107683697 unclassified probably benign
IGL02070:Sema3f APN 9 107692241 missense probably damaging 1.00
IGL02381:Sema3f APN 9 107692395 missense probably damaging 1.00
IGL02472:Sema3f APN 9 107687736 missense probably damaging 1.00
IGL02557:Sema3f APN 9 107687212 missense probably damaging 1.00
IGL02614:Sema3f APN 9 107682511 missense probably benign 0.28
IGL02660:Sema3f APN 9 107683984 missense probably benign 0.05
R1468:Sema3f UTSW 9 107687572 unclassified probably benign
R1905:Sema3f UTSW 9 107684376 missense probably damaging 1.00
R4728:Sema3f UTSW 9 107705440 missense probably benign 0.00
R4772:Sema3f UTSW 9 107689720 nonsense probably null
R4786:Sema3f UTSW 9 107682682 missense probably benign 0.45
R4845:Sema3f UTSW 9 107685501 missense probably damaging 1.00
R5418:Sema3f UTSW 9 107692621 missense probably damaging 1.00
R5849:Sema3f UTSW 9 107682616 missense probably damaging 0.98
R5929:Sema3f UTSW 9 107692193 missense probably damaging 1.00
R6968:Sema3f UTSW 9 107691449 critical splice acceptor site probably null
R7043:Sema3f UTSW 9 107691400 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- AATACTGTCTTTGCAGGGGTAG -3'
(R):5'- CACAAACGTGGTGGTCTCAC -3'

Sequencing Primer
(F):5'- GCTAGGCTGGTCCTATGCAG -3'
(R):5'- TCTCACCTGGAAGCTGGCTAG -3'
Posted On2016-12-15