Incidental Mutation 'R5780:Fscn2'
ID446948
Institutional Source Beutler Lab
Gene Symbol Fscn2
Ensembl Gene ENSMUSG00000025380
Gene Namefascin actin-bundling protein 2
SynonymsC630046B20Rik, ahl8
MMRRC Submission 043205-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.175) question?
Stock #R5780 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location120361534-120368168 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 120366668 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Alanine at position 285 (E285A)
Ref Sequence ENSEMBL: ENSMUSP00000026445 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026445] [ENSMUST00000026448]
Predicted Effect probably benign
Transcript: ENSMUST00000026445
AA Change: E285A

PolyPhen 2 Score 0.142 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000026445
Gene: ENSMUSG00000025380
AA Change: E285A

DomainStartEndE-ValueType
Pfam:Fascin 20 133 4.9e-34 PFAM
Pfam:Fascin 141 254 1.2e-26 PFAM
Pfam:Fascin 266 376 8.9e-35 PFAM
Pfam:Fascin 389 492 4.1e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000026448
SMART Domains Protein: ENSMUSP00000026448
Gene: ENSMUSG00000025384

DomainStartEndE-ValueType
Pfam:FANCAA 447 879 1.4e-196 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129203
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130476
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135635
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152556
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the fascin protein family. Fascins crosslink actin into filamentous bundles within dynamic cell extensions. This family member is proposed to play a role in photoreceptor disk morphogenesis. A mutation in this gene results in one form of autosomal dominant retinitis pigmentosa and macular degeneration. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display retinal generation with structural abnormalities of the outer segment and depressed rod and cone ERGs that worsen with age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630001G21Rik C T 1: 85,718,318 A189T probably benign Het
Acsm4 A G 7: 119,693,845 E66G possibly damaging Het
Afm A G 5: 90,551,431 E578G possibly damaging Het
Alox5 A T 6: 116,420,349 D291E probably benign Het
Apoa4 A G 9: 46,242,592 M164V possibly damaging Het
Atp6v1a A T 16: 44,114,643 M61K probably benign Het
Avp A G 2: 130,580,709 S159P probably benign Het
Bicra A T 7: 15,979,754 L841Q possibly damaging Het
Cdk5rap1 CTT CT 2: 154,345,868 probably null Het
Clasp2 T G 9: 113,850,152 L246R probably damaging Het
Dhdds G A 4: 133,996,830 L58F probably damaging Het
Dmkn A G 7: 30,777,615 D227G probably damaging Het
Dnah7a G A 1: 53,483,319 A2920V probably benign Het
Epb41l1 C T 2: 156,496,525 R163W probably damaging Het
Etfbkmt T A 6: 149,147,159 Y99N probably damaging Het
Fat4 T C 3: 38,980,955 Y2919H probably damaging Het
Fcgbp T A 7: 28,085,218 D234E probably benign Het
Frem1 T C 4: 82,950,415 D1443G probably benign Het
Gm12794 C T 4: 101,941,527 L232F probably damaging Het
Gm14124 T A 2: 150,266,219 M33K probably benign Het
Hmga2 T A 10: 120,462,678 R79* probably null Het
Hrh3 A T 2: 180,100,815 V308E probably damaging Het
Hsd11b2 G A 8: 105,522,155 G93D probably damaging Het
Hydin T C 8: 110,586,080 F4151S probably damaging Het
Ica1l C A 1: 60,028,215 E5D probably benign Het
Kcnma1 C A 14: 23,386,351 E640* probably null Het
Mdn1 C T 4: 32,722,950 H2422Y probably benign Het
Mgarp T C 3: 51,391,848 T47A probably damaging Het
Mmp13 T G 9: 7,278,952 F348V possibly damaging Het
Mov10l1 A G 15: 89,011,978 D675G probably benign Het
Nxpe3 T A 16: 55,866,441 Q68L probably damaging Het
Olfr1287 A T 2: 111,449,833 D231V probably benign Het
Olfr784 T C 10: 129,388,070 S146P probably damaging Het
Olfr869 T A 9: 20,137,497 M127K probably damaging Het
Pald1 A T 10: 61,339,218 I751N probably damaging Het
Prickle2 T C 6: 92,458,612 T3A probably benign Het
Ros1 A T 10: 52,194,857 C34S probably damaging Het
Sema3f A G 9: 107,682,589 L702P probably damaging Het
Soga1 A G 2: 157,018,490 C1610R probably damaging Het
Sptbn2 T A 19: 4,724,667 L116Q probably damaging Het
Stard9 T C 2: 120,703,396 V3378A probably benign Het
Sycp2l A G 13: 41,129,500 I158V possibly damaging Het
Tbc1d10b G A 7: 127,198,753 R739W possibly damaging Het
Tnik T C 3: 28,594,092 M431T probably benign Het
Ube4b C T 4: 149,331,364 R1091Q probably benign Het
Vwce C A 19: 10,650,619 P481Q probably damaging Het
Other mutations in Fscn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01684:Fscn2 APN 11 120367305 missense probably damaging 0.99
IGL01767:Fscn2 APN 11 120367750 missense possibly damaging 0.82
IGL02212:Fscn2 APN 11 120362055 missense probably damaging 1.00
IGL02299:Fscn2 APN 11 120362199 missense probably benign 0.09
IGL02494:Fscn2 APN 11 120362402 missense probably benign 0.02
IGL02716:Fscn2 APN 11 120366724 missense probably benign 0.00
IGL02882:Fscn2 APN 11 120362499 missense probably benign
IGL02986:Fscn2 APN 11 120367350 missense possibly damaging 0.74
ANU74:Fscn2 UTSW 11 120362336 missense probably damaging 1.00
R0277:Fscn2 UTSW 11 120368011 missense probably damaging 1.00
R0323:Fscn2 UTSW 11 120368011 missense probably damaging 1.00
R0513:Fscn2 UTSW 11 120361880 missense probably damaging 1.00
R1451:Fscn2 UTSW 11 120362022 missense probably damaging 0.98
R1620:Fscn2 UTSW 11 120366685 missense probably damaging 1.00
R1736:Fscn2 UTSW 11 120368026 missense probably damaging 1.00
R2212:Fscn2 UTSW 11 120361591 start gained probably benign
R2327:Fscn2 UTSW 11 120366701 missense probably damaging 1.00
R2384:Fscn2 UTSW 11 120366733 missense possibly damaging 0.48
R2397:Fscn2 UTSW 11 120362169 missense probably damaging 1.00
R4624:Fscn2 UTSW 11 120367343 missense probably benign 0.21
R4634:Fscn2 UTSW 11 120367720 missense possibly damaging 0.65
R4784:Fscn2 UTSW 11 120367987 missense possibly damaging 0.82
R5062:Fscn2 UTSW 11 120366749 missense probably damaging 1.00
R5084:Fscn2 UTSW 11 120361860 missense probably damaging 0.96
R5514:Fscn2 UTSW 11 120368032 missense probably damaging 1.00
R6073:Fscn2 UTSW 11 120361787 nonsense probably null
R6345:Fscn2 UTSW 11 120362027 missense probably damaging 0.99
R7110:Fscn2 UTSW 11 120366754 missense probably benign 0.19
R7170:Fscn2 UTSW 11 120362509 missense probably damaging 0.98
R7171:Fscn2 UTSW 11 120362509 missense probably damaging 0.98
R7538:Fscn2 UTSW 11 120367326 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- ATCCTTAGAGGCATGTCTGTG -3'
(R):5'- ATGACCGAAGTGACAGTGGTC -3'

Sequencing Primer
(F):5'- CCTTAGAGGCATGTCTGTGTGAGG -3'
(R):5'- CAGATCTCTGGGTTGGAAACTAC -3'
Posted On2016-12-15