Incidental Mutation 'R5791:Olfr980'
ID446977
Institutional Source Beutler Lab
Gene Symbol Olfr980
Ensembl Gene ENSMUSG00000060254
Gene Nameolfactory receptor 980
SynonymsMOR223-2, GA_x6K02T2PVTD-33705428-33704496
MMRRC Submission 043207-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R5791 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location40004348-40009582 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 40006734 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 72 (S72T)
Ref Sequence ENSEMBL: ENSMUSP00000150496 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073932] [ENSMUST00000215523] [ENSMUST00000216463]
Predicted Effect probably damaging
Transcript: ENSMUST00000073932
AA Change: S72T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000091386
Gene: ENSMUSG00000060254
AA Change: S72T

DomainStartEndE-ValueType
Pfam:7tm_4 29 304 1.4e-55 PFAM
Pfam:7tm_1 39 287 5.4e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215523
Predicted Effect probably damaging
Transcript: ENSMUST00000216463
AA Change: S72T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam25 G C 8: 40,754,220 Q174H probably benign Het
Adipor2 A T 6: 119,361,905 M129K possibly damaging Het
AI314180 C T 4: 58,814,027 E1360K possibly damaging Het
AI314180 T A 4: 58,822,111 D1152V probably damaging Het
Arhgap29 T A 3: 122,014,245 M616K probably damaging Het
Calcrl A T 2: 84,351,265 F180I probably damaging Het
Cdh4 T C 2: 179,895,767 V864A probably damaging Het
Cep78 A G 19: 15,961,072 F504S probably benign Het
Coasy A G 11: 101,084,385 probably null Het
Dnah3 T C 7: 119,931,473 N751S probably benign Het
Eea1 T A 10: 96,019,995 N631K probably benign Het
Fam149b A G 14: 20,351,326 K27R probably damaging Het
Fbxw26 A G 9: 109,745,153 W42R probably damaging Het
Gas6 A G 8: 13,470,217 probably null Het
Gfral C T 9: 76,197,046 R228Q probably benign Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gmppa T C 1: 75,442,255 V324A possibly damaging Het
Gstm2 C T 3: 107,984,128 probably null Het
Kcng3 A G 17: 83,588,210 S276P probably benign Het
Lrrd1 T C 5: 3,851,254 S520P probably benign Het
Lrrn2 A G 1: 132,937,767 N190S probably benign Het
Lrwd1 G C 5: 136,131,033 A392G probably benign Het
Mab21l2 A G 3: 86,546,737 Y319H probably damaging Het
Ndufv3 A G 17: 31,527,408 N91D probably benign Het
Nfatc2 T A 2: 168,536,393 M451L probably benign Het
Pcdhgb2 G T 18: 37,692,340 V795F possibly damaging Het
Pdcd11 T A 19: 47,110,991 M843K possibly damaging Het
Pla2g4c T A 7: 13,339,692 N221K probably benign Het
Ppox T C 1: 171,277,312 Y422C probably damaging Het
Retreg3 A G 11: 101,100,943 S55P probably damaging Het
Rnf103 C A 6: 71,508,925 T180K probably damaging Het
Tbl3 A T 17: 24,704,434 L307H probably damaging Het
Tex26 A T 5: 149,439,775 probably null Het
Tln2 A T 9: 67,386,605 I247K probably damaging Het
Txlnb T C 10: 17,799,128 S10P probably benign Het
Vwde C A 6: 13,195,986 E347* probably null Het
Wasf1 G A 10: 40,926,574 R75Q probably damaging Het
Zfp14 A G 7: 30,038,262 S433P probably damaging Het
Zfp647 G T 15: 76,918,006 A2E unknown Het
Other mutations in Olfr980
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02256:Olfr980 APN 9 40006053 missense probably benign
IGL02378:Olfr980 APN 9 40006473 missense probably damaging 1.00
IGL03384:Olfr980 APN 9 40006470 missense probably benign
IGL03402:Olfr980 APN 9 40006506 missense probably benign 0.31
PIT4651001:Olfr980 UTSW 9 40006230 missense probably damaging 0.97
R0013:Olfr980 UTSW 9 40006355 missense probably damaging 1.00
R1146:Olfr980 UTSW 9 40006094 missense possibly damaging 0.95
R1146:Olfr980 UTSW 9 40006094 missense possibly damaging 0.95
R4541:Olfr980 UTSW 9 40006293 missense possibly damaging 0.95
R4562:Olfr980 UTSW 9 40006281 missense probably damaging 0.99
R4731:Olfr980 UTSW 9 40006268 missense probably damaging 1.00
R4732:Olfr980 UTSW 9 40006268 missense probably damaging 1.00
R4733:Olfr980 UTSW 9 40006268 missense probably damaging 1.00
R4825:Olfr980 UTSW 9 40006742 missense possibly damaging 0.72
R5619:Olfr980 UTSW 9 40006743 missense probably benign 0.07
R5770:Olfr980 UTSW 9 40006338 missense probably benign 0.01
R6813:Olfr980 UTSW 9 40006457 missense probably benign
R6819:Olfr980 UTSW 9 40006548 missense probably benign 0.00
R6970:Olfr980 UTSW 9 40006713 missense probably benign 0.00
Z1088:Olfr980 UTSW 9 40006596 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACTCATCATGCTGCTGTACC -3'
(R):5'- TGGAAGTGTAGTGACCACGTTC -3'

Sequencing Primer
(F):5'- CATCATGCTGCTGTACCTGAGTG -3'
(R):5'- AAGTGTAGTGACCACGTTCTTCCTC -3'
Posted On2016-12-15