Incidental Mutation 'R5792:Zap70'
ID446999
Institutional Source Beutler Lab
Gene Symbol Zap70
Ensembl Gene ENSMUSG00000026117
Gene Namezeta-chain (TCR) associated protein kinase
SynonymsZAP-70, TZK, Srk
Accession Numbers

Genbank: NM_009539; MGI: 99613

 

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5792 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location36761798-36782818 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 36779009 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000027291 (fasta)
Gene Model predicted gene model for transcript(s):
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190128
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 95% (56/59)
MGI Phenotype Mutant mice show T cell defects. Null mutants lack alpha-beta T cells in the thymus and have fewer T cells in dendritic and intestinal epithelium. Spontaneous and knock-in missense mutations affect T cell receptor signaling, one of the former resulting in severe chronic arthritis.
Allele List at MGI

All alleles(15) : Targeted, knock-out(2) Targeted, other(7) Gene trapped(1) Spontaneous(2) Chemically induced(3)

Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A T 7: 40,993,521 I296F possibly damaging Het
Adamts19 C T 18: 58,837,512 T56M possibly damaging Het
Armc4 T C 18: 7,217,965 N583S probably benign Het
Axdnd1 T G 1: 156,341,889 E802D probably damaging Het
Birc6 T C 17: 74,631,053 V2630A probably benign Het
Capn5 A T 7: 98,131,195 F323I probably benign Het
Cdc25b A G 2: 131,191,759 E206G probably damaging Het
Cmah T G 13: 24,456,915 N382K probably benign Het
Col11a1 A T 3: 114,131,593 D25V probably damaging Het
Cyp2d41-ps G T 15: 82,779,220 noncoding transcript Het
Cyp3a59 A G 5: 146,099,851 K288E possibly damaging Het
Cyr61 T C 3: 145,648,658 D166G probably benign Het
Dclre1a A C 19: 56,529,590 I1019S probably damaging Het
Fat2 G T 11: 55,262,325 A3687D possibly damaging Het
Flg2 T A 3: 93,203,497 V944E unknown Het
Galntl5 T C 5: 25,198,463 V177A possibly damaging Het
Gm12695 T C 4: 96,728,283 T438A probably benign Het
Gm14295 A T 2: 176,811,014 N766Y probably benign Het
Gm15433 T A 1: 84,964,112 N148K noncoding transcript Het
Gm2431 C T 7: 142,258,332 G8E unknown Het
Gm5435 T A 12: 82,495,426 Q371L unknown Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Grip1 T C 10: 119,985,480 I350T probably benign Het
Guf1 T A 5: 69,560,486 F196I probably damaging Het
Kcng4 G T 8: 119,626,279 D297E probably damaging Het
Khdrbs2 G A 1: 32,472,692 R246Q probably damaging Het
Layn T C 9: 51,068,161 E148G probably damaging Het
Lrig3 T A 10: 126,009,919 V739E probably damaging Het
Lyg1 A G 1: 37,947,267 W129R probably benign Het
Nup210l C T 3: 90,199,857 T1567I probably damaging Het
Nus1 T A 10: 52,429,256 L164* probably null Het
Olfr2 A T 7: 107,001,443 V139D possibly damaging Het
Olfr354 A G 2: 36,907,101 I52V probably benign Het
Otop1 A G 5: 38,297,916 N215S probably benign Het
Pcif1 T A 2: 164,885,379 N90K probably damaging Het
Phf2 T C 13: 48,820,042 probably null Het
Piezo2 T A 18: 63,146,856 I215F probably damaging Het
Pitpnm2 G T 5: 124,130,321 C553* probably null Het
Prdm1 A G 10: 44,450,228 V133A probably damaging Het
Prkdc A G 16: 15,816,752 D3587G probably damaging Het
Sez6l A T 5: 112,422,024 Y960* probably null Het
Sh3rf2 A C 18: 42,111,138 H255P probably damaging Het
Slco1a5 C T 6: 142,242,113 C500Y probably damaging Het
Slf1 T A 13: 77,066,737 H610L probably benign Het
Syn3 T C 10: 86,294,628 *244W probably null Het
Sytl2 A T 7: 90,375,689 D295V probably damaging Het
Tnfrsf1a T A 6: 125,358,077 C166S probably null Het
Ttc6 T G 12: 57,673,204 L854V possibly damaging Het
Ttn T C 2: 76,766,258 I18358V probably benign Het
Vmn2r108 A G 17: 20,463,136 V602A probably damaging Het
Zfhx2 T C 14: 55,066,846 E1227G possibly damaging Het
Znhit3 G A 11: 84,916,084 noncoding transcript Het
Zpbp2 A G 11: 98,551,410 unknown Het
Other mutations in Zap70
AlleleSourceChrCoordTypePredicted EffectPPH Score
mrtless APN 1 36781149 missense probably damaging 1.00
murdock APN 1 36779704 missense possibly damaging 0.95
IGL00763:Zap70 APN 1 36779252 missense possibly damaging 0.81
IGL01635:Zap70 APN 1 36771157 missense probably damaging 0.99
IGL01918:Zap70 APN 1 36778787 missense possibly damaging 0.64
IGL02164:Zap70 APN 1 36771186 missense probably damaging 0.99
IGL02502:Zap70 APN 1 36778806 unclassified noncoding transcript
IGL02597:Zap70 APN 1 36771920 nonsense probably null
IGL03026:Zap70 APN 1 36779717 missense possibly damaging 0.94
biscayne UTSW 1 36781412 missense
mesa_verde UTSW 1 36779173 missense probably damaging 1.00
trebia UTSW 1 36781025 missense probably damaging 1.00
wanna UTSW 1 36770983 missense probably damaging 1.00
wanna2 UTSW 1 36781412 missense probably damaging 1.00
wanna3 UTSW 1 36778218 missense probably damaging 0.99
wanna4 UTSW 1 36781365 missense probably damaging 1.00
waterfowl UTSW 1 36770811 start codon destroyed probably null 0.03
PIT1430001:Zap70 UTSW 1 36779169 missense possibly damaging 0.95
R0487:Zap70 UTSW 1 36779284 missense probably damaging 1.00
R0701:Zap70 UTSW 1 36781177 missense probably damaging 1.00
R0960:Zap70 UTSW 1 36779173 missense probably damaging 1.00
R1520:Zap70 UTSW 1 36770955 missense probably damaging 1.00
R2064:Zap70 UTSW 1 36779134 missense probably benign
R3623:Zap70 UTSW 1 36779135 missense probably benign 0.03
R3689:Zap70 UTSW 1 36781412 missense probably damaging 1.00
R3690:Zap70 UTSW 1 36781412 missense probably damaging 1.00
R3804:Zap70 UTSW 1 36771142 missense possibly damaging 0.58
R3840:Zap70 UTSW 1 36778417 missense probably damaging 1.00
R4260:Zap70 UTSW 1 36779108 splice site noncoding transcript
R4383:Zap70 UTSW 1 36780961 missense probably damaging 1.00
R4632:Zap70 UTSW 1 36778458 missense probably benign
R4783:Zap70 UTSW 1 36779173 missense probably damaging 1.00
R5051:Zap70 UTSW 1 36781451 missense probably benign 0.00
R5271:Zap70 UTSW 1 36781365 missense probably damaging 1.00
R5304:Zap70 UTSW 1 36778218 missense probably damaging 0.99
R5932:Zap70 UTSW 1 36781146 missense probably damaging 1.00
R5941:Zap70 UTSW 1 36770949 missense probably damaging 1.00
S24628:Zap70 UTSW 1 36770811 start codon destroyed probably null 0.03
Predicted Primers PCR Primer
(F):5'- CTTTAGCCTCAGAGACGAGTG -3'
(R):5'- GGGACTCTCGTACACACTTG -3'

Sequencing Primer
(F):5'- AGTGGACACCCTGAACTCG -3'
(R):5'- ACACTTGTGTCCATGGGC -3'
Posted OnDec 15, 2016