Incidental Mutation 'R0544:Trim37'
ID44700
Institutional Source Beutler Lab
Gene Symbol Trim37
Ensembl Gene ENSMUSG00000018548
Gene Nametripartite motif-containing 37
SynonymsMUL, 1110032A10Rik, 2810004E07Rik, TEF3
MMRRC Submission 038736-MU
Accession Numbers

Genbank: NM_197987

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0544 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location87127077-87220683 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 87145502 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 121 (Y121*)
Ref Sequence ENSEMBL: ENSMUSP00000119269 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041282] [ENSMUST00000139532]
Predicted Effect probably null
Transcript: ENSMUST00000041282
AA Change: Y136*
SMART Domains Protein: ENSMUSP00000049057
Gene: ENSMUSG00000018548
AA Change: Y136*

DomainStartEndE-ValueType
RING 15 54 1.71e-1 SMART
BBOX 90 132 7.32e-12 SMART
BBC 132 254 3.05e-31 SMART
MATH 281 384 1.51e-13 SMART
low complexity region 494 504 N/A INTRINSIC
low complexity region 516 529 N/A INTRINSIC
low complexity region 535 545 N/A INTRINSIC
low complexity region 579 588 N/A INTRINSIC
low complexity region 612 626 N/A INTRINSIC
low complexity region 795 808 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000139532
AA Change: Y121*
SMART Domains Protein: ENSMUSP00000119269
Gene: ENSMUSG00000018548
AA Change: Y121*

DomainStartEndE-ValueType
BBOX 75 117 7.32e-12 SMART
Meta Mutation Damage Score 0.62 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 98% (97/99)
MGI Phenotype FUNCTION: The protein encoded by this gene is part of the tripartite-motif containing family (TRIM), which is typified by the RING, B-box type 1, B-box type 2, and coiled-coil region domains. In mouse this protein is proposed to oligomerize through its coiled coil domain and has been reported to be expressed in neural crest-derived tissues as well as in tissues whose development is regulated by mesenchymal-epithelial interactions. In humans, mutations in this gene are associated with mulibrey (muscle-liver-brain-eye) nanism, an autosomal recessive disorder characterized by prenatal onset growth failure, cardiomyopathy and dysmorphic features. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a knock-out allele are infertile due to gonadal degeneration and exhibit late-onset weight loss, smaller skull size, non-compaction cardiomyopathy, hepatomegaly, fatty liver, altered glucose metabolism, splenomegaly, and increased tumor incidence. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Gene trapped(7)

Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930012K11Rik A T 14: 70,157,314 F130L probably benign Het
Aatf C T 11: 84,423,005 R511Q probably benign Het
Acot12 A T 13: 91,784,656 D516V probably benign Het
Adgrb2 T C 4: 130,017,542 V1207A probably damaging Het
Akap9 A G 5: 4,069,185 D3564G probably benign Het
Arl8b C T 6: 108,783,228 probably benign Het
Atf6b T C 17: 34,648,299 probably null Het
Atrn G A 2: 130,986,826 G1097D probably damaging Het
Btbd6 A G 12: 112,977,082 E61G probably damaging Het
Car15 A G 16: 17,835,816 probably benign Het
Car5b G A X: 163,979,301 R282C probably damaging Het
Carmil2 C T 8: 105,691,235 A654V probably damaging Het
Cbwd1 A G 19: 24,949,211 Y159H possibly damaging Het
Ccdc88b A G 19: 6,857,266 L124P probably damaging Het
Ccnd1 A G 7: 144,937,286 probably benign Het
Cd3eap G T 7: 19,359,141 P38Q probably damaging Het
Cenph A G 13: 100,772,741 S53P probably damaging Het
Chrm3 T A 13: 9,877,579 I474F probably damaging Het
Cln8 T A 8: 14,896,769 V261E probably benign Het
Coa6 A G 8: 126,422,760 D25G probably benign Het
Col4a1 T G 8: 11,226,487 probably benign Het
Cpxm1 T C 2: 130,393,135 H588R probably damaging Het
Cul7 T C 17: 46,663,544 L1516P possibly damaging Het
Dcdc5 A G 2: 106,351,564 noncoding transcript Het
Ddx5 T C 11: 106,782,462 probably benign Het
Dhx16 C A 17: 35,881,659 P161Q probably benign Het
Dpy19l1 A T 9: 24,485,110 probably benign Het
Fastkd5 A G 2: 130,615,296 V458A probably damaging Het
Fhit A G 14: 9,870,172 V99A probably damaging Het
Fndc3a A T 14: 72,557,622 probably benign Het
Foxd4 A T 19: 24,899,818 S339R possibly damaging Het
Gm10842 T A 11: 105,147,054 D54E unknown Het
Gns T A 10: 121,376,267 Y94* probably null Het
Gp2 A G 7: 119,454,496 W81R probably benign Het
Hdac5 T G 11: 102,196,096 Q46P probably damaging Het
Homer2 A C 7: 81,649,678 V13G probably damaging Het
Irs3 A G 5: 137,643,839 S446P probably benign Het
Ism2 G T 12: 87,285,339 D141E probably damaging Het
Jak1 T A 4: 101,191,625 M19L probably benign Het
Kcnd3 C A 3: 105,658,759 R419S probably damaging Het
Lamb1 T C 12: 31,282,695 F272S probably damaging Het
Ldlrad2 T G 4: 137,572,268 T82P possibly damaging Het
Lrp2 T C 2: 69,491,931 K1885E probably benign Het
Mbd5 T C 2: 49,257,209 V477A possibly damaging Het
Mrps33 A T 6: 39,805,554 M11K possibly damaging Het
Mylk G C 16: 34,879,475 E403Q possibly damaging Het
Myom2 T A 8: 15,069,796 V184E probably damaging Het
Ncor1 C A 11: 62,333,776 G1210V probably damaging Het
Ncor1 C T 11: 62,333,777 G1210R probably damaging Het
Nlrp4a A G 7: 26,457,130 D760G probably benign Het
Noc4l A G 5: 110,651,123 V231A possibly damaging Het
Olfr1056 T C 2: 86,355,663 T240A probably damaging Het
Olfr1217 T C 2: 89,023,826 Y59C probably damaging Het
Olfr1306 A T 2: 111,912,560 Y123* probably null Het
Olfr1450 A G 19: 12,953,702 T38A possibly damaging Het
Olfr193 T A 16: 59,110,225 K128N probably benign Het
Olfr521 T C 7: 99,767,660 I166T probably benign Het
Olfr598 T A 7: 103,328,651 I55N probably damaging Het
Olfr733 A T 14: 50,298,682 V209E probably benign Het
Padi4 GCTGCGTACCTCCAC GC 4: 140,748,449 probably benign Het
Patj T A 4: 98,569,110 M1283K probably damaging Het
Pkd1 C T 17: 24,585,683 T790I probably damaging Het
Plod3 C A 5: 136,991,611 T526K probably benign Het
Plxnb2 C A 15: 89,158,613 probably benign Het
Pramel1 T A 4: 143,397,605 D283E possibly damaging Het
Prpf40a T C 2: 53,141,651 probably benign Het
Psg23 A T 7: 18,614,682 Y67N probably damaging Het
Rftn1 T A 17: 49,994,261 Q242L possibly damaging Het
Rp1l1 A T 14: 64,032,066 E1700D probably benign Het
Scube3 T C 17: 28,164,153 F435S probably damaging Het
Sdk2 T C 11: 113,781,010 Y2104C probably damaging Het
Sept11 A G 5: 93,165,368 E358G possibly damaging Het
Sh3bp1 T C 15: 78,905,775 L246P probably damaging Het
Sis T C 3: 72,951,642 Y352C probably damaging Het
Skint1 T C 4: 112,021,365 S165P probably damaging Het
Skint10 C T 4: 112,728,811 probably benign Het
Slc1a2 A T 2: 102,756,072 R340S probably damaging Het
Slc26a3 C A 12: 31,447,740 Q48K probably benign Het
Slc5a2 A T 7: 128,269,999 Y317F probably damaging Het
Sorbs3 T A 14: 70,193,926 T262S probably benign Het
Tas2r118 G T 6: 23,969,401 S220R probably damaging Het
Terf2ip C A 8: 112,015,342 Q223K possibly damaging Het
Tespa1 A G 10: 130,360,811 Q206R probably damaging Het
Tex10 T C 4: 48,462,766 probably null Het
Tle1 T A 4: 72,124,990 K547N probably damaging Het
Tmem131l T A 3: 83,898,546 Q1530L probably damaging Het
Tomm20l A G 12: 71,123,077 E145G possibly damaging Het
Tra2a C T 6: 49,250,951 probably benign Het
Trim32 G A 4: 65,613,254 R16Q probably damaging Het
Tube1 C T 10: 39,140,945 probably null Het
Usp6nl T A 2: 6,421,009 V187D probably damaging Het
Vmn1r13 T C 6: 57,210,263 F136L probably benign Het
Vmn1r201 A T 13: 22,475,146 I177F probably benign Het
Vmn1r203 A T 13: 22,524,273 T75S possibly damaging Het
Vmn1r225 C T 17: 20,502,456 S53L probably benign Het
Xab2 A T 8: 3,610,994 W707R probably damaging Het
Zfp808 T C 13: 62,169,434 probably benign Het
Other mutations in Trim37
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00708:Trim37 APN 11 87186393 missense probably damaging 1.00
IGL01372:Trim37 APN 11 87184946 missense probably benign 0.00
IGL01510:Trim37 APN 11 87177860 missense probably damaging 1.00
IGL02055:Trim37 APN 11 87166649 missense probably benign 0.44
IGL02106:Trim37 APN 11 87201404 nonsense probably null
IGL02251:Trim37 APN 11 87167430 splice site probably benign
IGL02498:Trim37 APN 11 87185050 missense probably benign
IGL02836:Trim37 APN 11 87196959 missense probably benign 0.01
IGL03089:Trim37 APN 11 87190137 missense probably damaging 1.00
IGL03302:Trim37 APN 11 87147001 missense possibly damaging 0.89
IGL03347:Trim37 APN 11 87201621 missense possibly damaging 0.80
G5030:Trim37 UTSW 11 87143141 missense probably damaging 0.96
R0396:Trim37 UTSW 11 87146968 missense probably damaging 1.00
R0946:Trim37 UTSW 11 87146955 missense probably damaging 0.99
R1481:Trim37 UTSW 11 87129759 nonsense probably null
R1799:Trim37 UTSW 11 87178019 missense probably damaging 1.00
R1851:Trim37 UTSW 11 87218306 missense probably damaging 1.00
R2107:Trim37 UTSW 11 87159825 missense probably benign 0.04
R3878:Trim37 UTSW 11 87206002 missense probably benign 0.10
R4049:Trim37 UTSW 11 87140603 critical splice donor site probably null
R4224:Trim37 UTSW 11 87216463 missense probably damaging 1.00
R4486:Trim37 UTSW 11 87196825 missense probably benign 0.31
R5244:Trim37 UTSW 11 87218257 missense probably benign 0.10
R5343:Trim37 UTSW 11 87137603 missense probably damaging 0.98
R5417:Trim37 UTSW 11 87166679 missense probably damaging 1.00
R5894:Trim37 UTSW 11 87201440 missense probably damaging 0.99
R5911:Trim37 UTSW 11 87196837 nonsense probably null
R5957:Trim37 UTSW 11 87145551 missense probably damaging 1.00
R6159:Trim37 UTSW 11 87216548 critical splice donor site probably null
R6479:Trim37 UTSW 11 87216487 nonsense probably null
R6527:Trim37 UTSW 11 87190084 missense probably damaging 1.00
R7021:Trim37 UTSW 11 87167509 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCAAACACTGGCCCTGTTTTAAGAAG -3'
(R):5'- GCCCTCCCTAAAGCTGGAAATCTTAC -3'

Sequencing Primer
(F):5'- CTGGCCCTGTTTTAAGAAGATAAAGG -3'
(R):5'- gcaaccttagttcactcccc -3'
Posted On2013-06-11