Incidental Mutation 'R5792:Pcif1'
ID447007
Institutional Source Beutler Lab
Gene Symbol Pcif1
Ensembl Gene ENSMUSG00000039849
Gene NamePDX1 C-terminal inhibiting factor 1
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.159) question?
Stock #R5792 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location164879304-164894454 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 164885379 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 90 (N90K)
Ref Sequence ENSEMBL: ENSMUSP00000039555 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041643]
Predicted Effect probably damaging
Transcript: ENSMUST00000041643
AA Change: N90K

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000039555
Gene: ENSMUSG00000039849
AA Change: N90K

DomainStartEndE-ValueType
WW 44 77 4.34e-4 SMART
low complexity region 132 148 N/A INTRINSIC
Pfam:PCIF1_WW 445 620 7.1e-74 PFAM
low complexity region 675 686 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122810
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130213
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145327
Meta Mutation Damage Score 0.32 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 95% (56/59)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A T 7: 40,993,521 I296F possibly damaging Het
Adamts19 C T 18: 58,837,512 T56M possibly damaging Het
Armc4 T C 18: 7,217,965 N583S probably benign Het
Axdnd1 T G 1: 156,341,889 E802D probably damaging Het
Birc6 T C 17: 74,631,053 V2630A probably benign Het
Capn5 A T 7: 98,131,195 F323I probably benign Het
Cdc25b A G 2: 131,191,759 E206G probably damaging Het
Cmah T G 13: 24,456,915 N382K probably benign Het
Col11a1 A T 3: 114,131,593 D25V probably damaging Het
Cyp2d41-ps G T 15: 82,779,220 noncoding transcript Het
Cyp3a59 A G 5: 146,099,851 K288E possibly damaging Het
Cyr61 T C 3: 145,648,658 D166G probably benign Het
Dclre1a A C 19: 56,529,590 I1019S probably damaging Het
Fat2 G T 11: 55,262,325 A3687D possibly damaging Het
Flg2 T A 3: 93,203,497 V944E unknown Het
Galntl5 T C 5: 25,198,463 V177A possibly damaging Het
Gm12695 T C 4: 96,728,283 T438A probably benign Het
Gm14295 A T 2: 176,811,014 N766Y probably benign Het
Gm15433 T A 1: 84,964,112 noncoding transcript Het
Gm2431 C T 7: 142,258,332 G8E unknown Het
Gm5435 T A 12: 82,495,426 noncoding transcript Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Grip1 T C 10: 119,985,480 I350T probably benign Het
Guf1 T A 5: 69,560,486 F196I probably damaging Het
Kcng4 G T 8: 119,626,279 D297E probably damaging Het
Khdrbs2 G A 1: 32,472,692 R246Q probably damaging Het
Layn T C 9: 51,068,161 E148G probably damaging Het
Lrig3 T A 10: 126,009,919 V739E probably damaging Het
Lyg1 A G 1: 37,947,267 W129R probably benign Het
Nup210l C T 3: 90,199,857 T1567I probably damaging Het
Nus1 T A 10: 52,429,256 L12* probably null Het
Olfr2 A T 7: 107,001,443 V139D possibly damaging Het
Olfr354 A G 2: 36,907,101 I52V probably benign Het
Otop1 A G 5: 38,297,916 N218S probably benign Het
Phf2 T C 13: 48,820,042 probably null Het
Piezo2 T A 18: 63,146,856 I215F probably damaging Het
Pitpnm2 G T 5: 124,130,321 C553* probably null Het
Prdm1 A G 10: 44,450,228 V115A probably damaging Het
Prkdc A G 16: 15,816,752 D3587G probably damaging Het
Sez6l A T 5: 112,422,024 Y883* probably null Het
Sh3rf2 A C 18: 42,111,138 H223P probably damaging Het
Slco1a5 C T 6: 142,242,113 C500Y probably damaging Het
Slf1 T A 13: 77,066,737 H610L probably benign Het
Syn3 T C 10: 86,294,628 *244W probably null Het
Sytl2 A T 7: 90,375,689 D295V probably damaging Het
Tnfrsf1a T A 6: 125,358,077 C44S probably damaging Het
Ttc6 T G 12: 57,673,204 L854V possibly damaging Het
Ttn T C 2: 76,766,258 I18358V probably benign Het
Vmn2r108 A G 17: 20,463,136 V602A probably damaging Het
Zap70 A G 1: 36,779,009 probably benign Het
Zfhx2 T C 14: 55,066,846 E1227G possibly damaging Het
Znhit3 G A 11: 84,916,084 probably null Het
Zpbp2 A G 11: 98,551,410 probably benign Het
Other mutations in Pcif1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01161:Pcif1 APN 2 164885788 missense probably damaging 1.00
IGL01598:Pcif1 APN 2 164886611 missense possibly damaging 0.86
R0313:Pcif1 UTSW 2 164884419 missense probably damaging 0.97
R0329:Pcif1 UTSW 2 164889444 missense probably damaging 1.00
R0330:Pcif1 UTSW 2 164889444 missense probably damaging 1.00
R1070:Pcif1 UTSW 2 164889138 missense probably benign 0.01
R1350:Pcif1 UTSW 2 164886767 missense probably damaging 0.99
R1467:Pcif1 UTSW 2 164889138 missense probably benign 0.01
R1467:Pcif1 UTSW 2 164889138 missense probably benign 0.01
R1583:Pcif1 UTSW 2 164886727 missense probably damaging 1.00
R1640:Pcif1 UTSW 2 164885683 missense probably benign
R1852:Pcif1 UTSW 2 164888466 missense probably damaging 0.97
R2252:Pcif1 UTSW 2 164890879 missense probably benign 0.05
R2571:Pcif1 UTSW 2 164884211 missense probably damaging 1.00
R3879:Pcif1 UTSW 2 164885958 missense probably benign 0.40
R4956:Pcif1 UTSW 2 164889690 missense probably damaging 1.00
R5913:Pcif1 UTSW 2 164884492 intron probably benign
R6798:Pcif1 UTSW 2 164885791 missense possibly damaging 0.94
R6913:Pcif1 UTSW 2 164884304 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GGGTTACTAACAAGGCCTTTCAG -3'
(R):5'- GCCACATGTCCAAGGTAACC -3'

Sequencing Primer
(F):5'- CCTTTCAGAAGGTGAGGGAGTC -3'
(R):5'- GTAACCACTTACCAGCCAGG -3'
Posted On2016-12-15