Incidental Mutation 'R5792:Cyr61'
ID447011
Institutional Source Beutler Lab
Gene Symbol Cyr61
Ensembl Gene ENSMUSG00000028195
Gene Namecysteine rich protein 61
SynonymsCCN1
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.528) question?
Stock #R5792 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location145646976-145649981 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 145648658 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 166 (D166G)
Ref Sequence ENSEMBL: ENSMUSP00000029846 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029846]
Predicted Effect probably benign
Transcript: ENSMUST00000029846
AA Change: D166G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000029846
Gene: ENSMUSG00000028195
AA Change: D166G

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
IB 24 93 1.16e-24 SMART
VWC 100 163 9.94e-23 SMART
low complexity region 164 184 N/A INTRINSIC
TSP1 229 271 1.34e-5 SMART
CT 289 358 3.74e-24 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181247
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197148
Meta Mutation Damage Score 0.088 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 95% (56/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The secreted protein encoded by this gene is growth factor-inducible and promotes the adhesion of endothelial cells. The encoded protein interacts with several integrins and with heparan sulfate proteoglycan. This protein also plays a role in cell proliferation, differentiation, angiogenesis, apoptosis, and extracellular matrix formation. [provided by RefSeq, Sep 2011]
PHENOTYPE: Targeted null mice die pre- or perinatally, and none survive beyond 24 hrs of birth. About 30% of embryos die by E10.5 from defects in chorioallantoic fusion, whereas 70% die from placental vascular defects, including impaired allantoic vessel bifurcation, and loss of large-vessel integrity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A T 7: 40,993,521 I296F possibly damaging Het
Adamts19 C T 18: 58,837,512 T56M possibly damaging Het
Armc4 T C 18: 7,217,965 N583S probably benign Het
Axdnd1 T G 1: 156,341,889 E802D probably damaging Het
Birc6 T C 17: 74,631,053 V2630A probably benign Het
Capn5 A T 7: 98,131,195 F323I probably benign Het
Cdc25b A G 2: 131,191,759 E206G probably damaging Het
Cmah T G 13: 24,456,915 N382K probably benign Het
Col11a1 A T 3: 114,131,593 D25V probably damaging Het
Cyp2d41-ps G T 15: 82,779,220 noncoding transcript Het
Cyp3a59 A G 5: 146,099,851 K288E possibly damaging Het
Dclre1a A C 19: 56,529,590 I1019S probably damaging Het
Fat2 G T 11: 55,262,325 A3687D possibly damaging Het
Flg2 T A 3: 93,203,497 V944E unknown Het
Galntl5 T C 5: 25,198,463 V177A possibly damaging Het
Gm12695 T C 4: 96,728,283 T438A probably benign Het
Gm14295 A T 2: 176,811,014 N766Y probably benign Het
Gm15433 T A 1: 84,964,112 noncoding transcript Het
Gm2431 C T 7: 142,258,332 G8E unknown Het
Gm5435 T A 12: 82,495,426 noncoding transcript Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Grip1 T C 10: 119,985,480 I350T probably benign Het
Guf1 T A 5: 69,560,486 F196I probably damaging Het
Kcng4 G T 8: 119,626,279 D297E probably damaging Het
Khdrbs2 G A 1: 32,472,692 R246Q probably damaging Het
Layn T C 9: 51,068,161 E148G probably damaging Het
Lrig3 T A 10: 126,009,919 V739E probably damaging Het
Lyg1 A G 1: 37,947,267 W129R probably benign Het
Nup210l C T 3: 90,199,857 T1567I probably damaging Het
Nus1 T A 10: 52,429,256 L12* probably null Het
Olfr2 A T 7: 107,001,443 V139D possibly damaging Het
Olfr354 A G 2: 36,907,101 I52V probably benign Het
Otop1 A G 5: 38,297,916 N218S probably benign Het
Pcif1 T A 2: 164,885,379 N90K probably damaging Het
Phf2 T C 13: 48,820,042 probably null Het
Piezo2 T A 18: 63,146,856 I215F probably damaging Het
Pitpnm2 G T 5: 124,130,321 C553* probably null Het
Prdm1 A G 10: 44,450,228 V115A probably damaging Het
Prkdc A G 16: 15,816,752 D3587G probably damaging Het
Sez6l A T 5: 112,422,024 Y883* probably null Het
Sh3rf2 A C 18: 42,111,138 H223P probably damaging Het
Slco1a5 C T 6: 142,242,113 C500Y probably damaging Het
Slf1 T A 13: 77,066,737 H610L probably benign Het
Syn3 T C 10: 86,294,628 *244W probably null Het
Sytl2 A T 7: 90,375,689 D295V probably damaging Het
Tnfrsf1a T A 6: 125,358,077 C44S probably damaging Het
Ttc6 T G 12: 57,673,204 L854V possibly damaging Het
Ttn T C 2: 76,766,258 I18358V probably benign Het
Vmn2r108 A G 17: 20,463,136 V602A probably damaging Het
Zap70 A G 1: 36,779,009 probably benign Het
Zfhx2 T C 14: 55,066,846 E1227G possibly damaging Het
Znhit3 G A 11: 84,916,084 probably null Het
Zpbp2 A G 11: 98,551,410 probably benign Het
Other mutations in Cyr61
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00801:Cyr61 APN 3 145648610 missense probably damaging 0.96
IGL02500:Cyr61 APN 3 145648700 missense probably damaging 1.00
IGL02963:Cyr61 APN 3 145647875 missense probably damaging 1.00
IGL03170:Cyr61 APN 3 145649759 missense probably benign 0.01
R0018:Cyr61 UTSW 3 145649431 missense probably damaging 0.99
R0846:Cyr61 UTSW 3 145647770 missense possibly damaging 0.94
R0964:Cyr61 UTSW 3 145647748 missense probably damaging 1.00
R1234:Cyr61 UTSW 3 145649839 start gained probably benign
R1968:Cyr61 UTSW 3 145648210 missense probably damaging 0.99
R1989:Cyr61 UTSW 3 145647743 missense probably benign 0.31
R2071:Cyr61 UTSW 3 145648673 nonsense probably null
R5622:Cyr61 UTSW 3 145649320 missense probably damaging 1.00
R5639:Cyr61 UTSW 3 145648697 missense probably damaging 1.00
R5734:Cyr61 UTSW 3 145648268 missense probably damaging 1.00
R6129:Cyr61 UTSW 3 145649231 missense possibly damaging 0.85
R6689:Cyr61 UTSW 3 145647788 missense probably benign
R7131:Cyr61 UTSW 3 145648781 missense probably damaging 1.00
R7289:Cyr61 UTSW 3 145648673 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGCTTCTTAGATGCTTGCATAC -3'
(R):5'- ACCAAAACGGGGAAAGCTTC -3'

Sequencing Primer
(F):5'- CTTAGATGCTTGCATACACACACTGG -3'
(R):5'- GAAAGCTTCCAGCCCAACTG -3'
Posted On2016-12-15