Incidental Mutation 'R5792:Kcng4'
ID447027
Institutional Source Beutler Lab
Gene Symbol Kcng4
Ensembl Gene ENSMUSG00000045246
Gene Namepotassium voltage-gated channel, subfamily G, member 4
SynonymsKV6.4, 4921535I01Rik, KV6.3
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.027) question?
Stock #R5792 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location119623854-119635680 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 119626279 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 297 (D297E)
Ref Sequence ENSEMBL: ENSMUSP00000129687 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061828] [ENSMUST00000164382]
Predicted Effect probably damaging
Transcript: ENSMUST00000061828
AA Change: D297E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000056552
Gene: ENSMUSG00000045246
AA Change: D297E

DomainStartEndE-ValueType
BTB 58 168 7.13e-3 SMART
Pfam:Ion_trans 218 462 1.2e-40 PFAM
Pfam:Ion_trans_2 370 457 7e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000164382
AA Change: D297E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129687
Gene: ENSMUSG00000045246
AA Change: D297E

DomainStartEndE-ValueType
BTB 58 168 7.13e-3 SMART
Pfam:Ion_trans 262 451 6.6e-29 PFAM
Pfam:Ion_trans_2 371 457 1.7e-13 PFAM
Meta Mutation Damage Score 0.194 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 95% (56/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a member of the potassium channel, voltage-gated, subfamily G. This member functions as a modulatory subunit. The gene has strong expression in brain. Multiple alternatively spliced variants have been found in normal and cancerous tissues. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A T 7: 40,993,521 I296F possibly damaging Het
Adamts19 C T 18: 58,837,512 T56M possibly damaging Het
Armc4 T C 18: 7,217,965 N583S probably benign Het
Axdnd1 T G 1: 156,341,889 E802D probably damaging Het
Birc6 T C 17: 74,631,053 V2630A probably benign Het
Capn5 A T 7: 98,131,195 F323I probably benign Het
Cdc25b A G 2: 131,191,759 E206G probably damaging Het
Cmah T G 13: 24,456,915 N382K probably benign Het
Col11a1 A T 3: 114,131,593 D25V probably damaging Het
Cyp2d41-ps G T 15: 82,779,220 noncoding transcript Het
Cyp3a59 A G 5: 146,099,851 K288E possibly damaging Het
Cyr61 T C 3: 145,648,658 D166G probably benign Het
Dclre1a A C 19: 56,529,590 I1019S probably damaging Het
Fat2 G T 11: 55,262,325 A3687D possibly damaging Het
Flg2 T A 3: 93,203,497 V944E unknown Het
Galntl5 T C 5: 25,198,463 V177A possibly damaging Het
Gm12695 T C 4: 96,728,283 T438A probably benign Het
Gm14295 A T 2: 176,811,014 N766Y probably benign Het
Gm15433 T A 1: 84,964,112 noncoding transcript Het
Gm2431 C T 7: 142,258,332 G8E unknown Het
Gm5435 T A 12: 82,495,426 noncoding transcript Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Grip1 T C 10: 119,985,480 I350T probably benign Het
Guf1 T A 5: 69,560,486 F196I probably damaging Het
Khdrbs2 G A 1: 32,472,692 R246Q probably damaging Het
Layn T C 9: 51,068,161 E148G probably damaging Het
Lrig3 T A 10: 126,009,919 V739E probably damaging Het
Lyg1 A G 1: 37,947,267 W129R probably benign Het
Nup210l C T 3: 90,199,857 T1567I probably damaging Het
Nus1 T A 10: 52,429,256 L12* probably null Het
Olfr2 A T 7: 107,001,443 V139D possibly damaging Het
Olfr354 A G 2: 36,907,101 I52V probably benign Het
Otop1 A G 5: 38,297,916 N218S probably benign Het
Pcif1 T A 2: 164,885,379 N90K probably damaging Het
Phf2 T C 13: 48,820,042 probably null Het
Piezo2 T A 18: 63,146,856 I215F probably damaging Het
Pitpnm2 G T 5: 124,130,321 C553* probably null Het
Prdm1 A G 10: 44,450,228 V115A probably damaging Het
Prkdc A G 16: 15,816,752 D3587G probably damaging Het
Sez6l A T 5: 112,422,024 Y883* probably null Het
Sh3rf2 A C 18: 42,111,138 H223P probably damaging Het
Slco1a5 C T 6: 142,242,113 C500Y probably damaging Het
Slf1 T A 13: 77,066,737 H610L probably benign Het
Syn3 T C 10: 86,294,628 *244W probably null Het
Sytl2 A T 7: 90,375,689 D295V probably damaging Het
Tnfrsf1a T A 6: 125,358,077 C44S probably damaging Het
Ttc6 T G 12: 57,673,204 L854V possibly damaging Het
Ttn T C 2: 76,766,258 I18358V probably benign Het
Vmn2r108 A G 17: 20,463,136 V602A probably damaging Het
Zap70 A G 1: 36,779,009 probably benign Het
Zfhx2 T C 14: 55,066,846 E1227G possibly damaging Het
Znhit3 G A 11: 84,916,084 probably null Het
Zpbp2 A G 11: 98,551,410 probably benign Het
Other mutations in Kcng4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00569:Kcng4 APN 8 119626331 missense probably benign 0.00
IGL01360:Kcng4 APN 8 119625677 missense probably benign 0.40
IGL02094:Kcng4 APN 8 119633221 missense probably damaging 0.98
IGL02205:Kcng4 APN 8 119626083 missense probably damaging 0.99
IGL02892:Kcng4 APN 8 119633082 missense probably benign
IGL02927:Kcng4 APN 8 119626322 missense probably benign
IGL02954:Kcng4 APN 8 119633053 missense probably benign
IGL03143:Kcng4 APN 8 119625770 missense probably damaging 1.00
FR4449:Kcng4 UTSW 8 119633519 nonsense probably null
FR4548:Kcng4 UTSW 8 119633519 nonsense probably null
FR4737:Kcng4 UTSW 8 119633519 nonsense probably null
FR4976:Kcng4 UTSW 8 119633519 nonsense probably null
LCD18:Kcng4 UTSW 8 119633519 nonsense probably null
R0017:Kcng4 UTSW 8 119633520 missense probably damaging 1.00
R1777:Kcng4 UTSW 8 119633487 missense probably benign 0.02
R1852:Kcng4 UTSW 8 119626208 missense probably benign 0.01
R1967:Kcng4 UTSW 8 119632923 missense probably damaging 1.00
R3886:Kcng4 UTSW 8 119633247 missense probably benign 0.34
R4009:Kcng4 UTSW 8 119626085 missense probably damaging 1.00
R5137:Kcng4 UTSW 8 119625878 missense possibly damaging 0.88
R5987:Kcng4 UTSW 8 119626359 missense probably damaging 1.00
R6339:Kcng4 UTSW 8 119632954 missense probably damaging 1.00
R6379:Kcng4 UTSW 8 119633620 nonsense probably null
R6430:Kcng4 UTSW 8 119633050 missense probably damaging 0.96
X0024:Kcng4 UTSW 8 119633367 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATCAGGAGACCAAACTCTCGG -3'
(R):5'- GGCTAACCCATTGCTTTTGTG -3'

Sequencing Primer
(F):5'- ACCAAACTCTCGGGCGCAG -3'
(R):5'- GGCTCTCACTCCAGGGAGAATG -3'
Posted On2016-12-15