Incidental Mutation 'R5792:Prdm1'
ID447029
Institutional Source Beutler Lab
Gene Symbol Prdm1
Ensembl Gene ENSMUSG00000038151
Gene NamePR domain containing 1, with ZNF domain
SynonymsBlimp1, b2b1765Clo, Blimp-1, PRDI-BF1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5792 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location44437177-44528501 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 44450228 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 115 (V115A)
Ref Sequence ENSEMBL: ENSMUSP00000151237 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039174] [ENSMUST00000105490] [ENSMUST00000218369]
Predicted Effect probably damaging
Transcript: ENSMUST00000039174
AA Change: V133A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039248
Gene: ENSMUSG00000038151
AA Change: V133A

DomainStartEndE-ValueType
SET 118 239 1.1e-19 SMART
low complexity region 359 393 N/A INTRINSIC
low complexity region 541 556 N/A INTRINSIC
ZnF_C2H2 606 628 6.42e-4 SMART
ZnF_C2H2 634 656 3.89e-3 SMART
ZnF_C2H2 662 684 7.26e-3 SMART
ZnF_C2H2 690 712 1.36e-2 SMART
ZnF_C2H2 718 738 1.12e2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105490
AA Change: V100A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101129
Gene: ENSMUSG00000038151
AA Change: V100A

DomainStartEndE-ValueType
SET 85 206 1.1e-19 SMART
low complexity region 326 360 N/A INTRINSIC
low complexity region 508 523 N/A INTRINSIC
ZnF_C2H2 573 595 6.42e-4 SMART
ZnF_C2H2 601 623 3.89e-3 SMART
ZnF_C2H2 629 651 7.26e-3 SMART
ZnF_C2H2 657 679 1.36e-2 SMART
ZnF_C2H2 685 705 1.12e2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167340
Predicted Effect probably damaging
Transcript: ENSMUST00000218369
AA Change: V115A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.362 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 95% (56/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that acts as a repressor of beta-interferon gene expression. The protein binds specifically to the PRDI (positive regulatory domain I element) of the beta-IFN gene promoter. Transcription of this gene increases upon virus induction. Two alternatively spliced transcript variants that encode different isoforms have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display embryonic lethality and impaired primordial germ cell development, while heterozygotes display a decreased numbers of primordial germ cells but normal migration. Conditional mutants display impaired plasma cell and pre-plasmamemory B cell development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A T 7: 40,993,521 I296F possibly damaging Het
Adamts19 C T 18: 58,837,512 T56M possibly damaging Het
Armc4 T C 18: 7,217,965 N583S probably benign Het
Axdnd1 T G 1: 156,341,889 E802D probably damaging Het
Birc6 T C 17: 74,631,053 V2630A probably benign Het
Capn5 A T 7: 98,131,195 F323I probably benign Het
Cdc25b A G 2: 131,191,759 E206G probably damaging Het
Cmah T G 13: 24,456,915 N382K probably benign Het
Col11a1 A T 3: 114,131,593 D25V probably damaging Het
Cyp2d41-ps G T 15: 82,779,220 noncoding transcript Het
Cyp3a59 A G 5: 146,099,851 K288E possibly damaging Het
Cyr61 T C 3: 145,648,658 D166G probably benign Het
Dclre1a A C 19: 56,529,590 I1019S probably damaging Het
Fat2 G T 11: 55,262,325 A3687D possibly damaging Het
Flg2 T A 3: 93,203,497 V944E unknown Het
Galntl5 T C 5: 25,198,463 V177A possibly damaging Het
Gm12695 T C 4: 96,728,283 T438A probably benign Het
Gm14295 A T 2: 176,811,014 N766Y probably benign Het
Gm15433 T A 1: 84,964,112 noncoding transcript Het
Gm2431 C T 7: 142,258,332 G8E unknown Het
Gm5435 T A 12: 82,495,426 noncoding transcript Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Grip1 T C 10: 119,985,480 I350T probably benign Het
Guf1 T A 5: 69,560,486 F196I probably damaging Het
Kcng4 G T 8: 119,626,279 D297E probably damaging Het
Khdrbs2 G A 1: 32,472,692 R246Q probably damaging Het
Layn T C 9: 51,068,161 E148G probably damaging Het
Lrig3 T A 10: 126,009,919 V739E probably damaging Het
Lyg1 A G 1: 37,947,267 W129R probably benign Het
Nup210l C T 3: 90,199,857 T1567I probably damaging Het
Nus1 T A 10: 52,429,256 L12* probably null Het
Olfr2 A T 7: 107,001,443 V139D possibly damaging Het
Olfr354 A G 2: 36,907,101 I52V probably benign Het
Otop1 A G 5: 38,297,916 N218S probably benign Het
Pcif1 T A 2: 164,885,379 N90K probably damaging Het
Phf2 T C 13: 48,820,042 probably null Het
Piezo2 T A 18: 63,146,856 I215F probably damaging Het
Pitpnm2 G T 5: 124,130,321 C553* probably null Het
Prkdc A G 16: 15,816,752 D3587G probably damaging Het
Sez6l A T 5: 112,422,024 Y883* probably null Het
Sh3rf2 A C 18: 42,111,138 H223P probably damaging Het
Slco1a5 C T 6: 142,242,113 C500Y probably damaging Het
Slf1 T A 13: 77,066,737 H610L probably benign Het
Syn3 T C 10: 86,294,628 *244W probably null Het
Sytl2 A T 7: 90,375,689 D295V probably damaging Het
Tnfrsf1a T A 6: 125,358,077 C44S probably damaging Het
Ttc6 T G 12: 57,673,204 L854V possibly damaging Het
Ttn T C 2: 76,766,258 I18358V probably benign Het
Vmn2r108 A G 17: 20,463,136 V602A probably damaging Het
Zap70 A G 1: 36,779,009 probably benign Het
Zfhx2 T C 14: 55,066,846 E1227G possibly damaging Het
Znhit3 G A 11: 84,916,084 probably null Het
Zpbp2 A G 11: 98,551,410 probably benign Het
Other mutations in Prdm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00657:Prdm1 APN 10 44441892 missense probably damaging 1.00
IGL01331:Prdm1 APN 10 44441974 missense possibly damaging 0.67
IGL02064:Prdm1 APN 10 44441342 missense probably damaging 1.00
IGL02669:Prdm1 APN 10 44439884 missense probably benign 0.28
IGL02944:Prdm1 APN 10 44441811 missense probably benign
IGL03295:Prdm1 APN 10 44439870 missense probably damaging 0.99
PIT4576001:Prdm1 UTSW 10 44458508 start codon destroyed probably null 0.05
R0008:Prdm1 UTSW 10 44441679 missense probably damaging 1.00
R0166:Prdm1 UTSW 10 44440091 missense probably damaging 1.00
R0226:Prdm1 UTSW 10 44456696 missense probably benign 0.03
R0284:Prdm1 UTSW 10 44456626 missense probably damaging 1.00
R0398:Prdm1 UTSW 10 44439809 missense probably damaging 1.00
R1200:Prdm1 UTSW 10 44450130 missense probably damaging 1.00
R1405:Prdm1 UTSW 10 44439965 missense probably damaging 1.00
R1405:Prdm1 UTSW 10 44439965 missense probably damaging 1.00
R1438:Prdm1 UTSW 10 44442128 missense probably benign 0.00
R1519:Prdm1 UTSW 10 44439986 nonsense probably null
R1886:Prdm1 UTSW 10 44439758 missense probably damaging 0.99
R2070:Prdm1 UTSW 10 44441412 missense possibly damaging 0.82
R2508:Prdm1 UTSW 10 44446807 missense probably benign 0.37
R3087:Prdm1 UTSW 10 44446827 missense probably damaging 1.00
R3150:Prdm1 UTSW 10 44458492 unclassified probably null
R4165:Prdm1 UTSW 10 44441576 missense probably benign 0.11
R4490:Prdm1 UTSW 10 44446907 nonsense probably null
R4647:Prdm1 UTSW 10 44439690 missense probably damaging 0.98
R4911:Prdm1 UTSW 10 44442052 missense possibly damaging 0.90
R4925:Prdm1 UTSW 10 44440169 missense probably damaging 1.00
R5153:Prdm1 UTSW 10 44450225 missense possibly damaging 0.94
R5247:Prdm1 UTSW 10 44440102 missense probably damaging 1.00
R6164:Prdm1 UTSW 10 44450195 missense probably damaging 1.00
R6247:Prdm1 UTSW 10 44446786 splice site probably null
R7196:Prdm1 UTSW 10 44456992 missense probably benign 0.14
R7270:Prdm1 UTSW 10 44441570 missense probably benign 0.07
Z1088:Prdm1 UTSW 10 44441925 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCCTGCTGTGTTGAAAG -3'
(R):5'- CCCGGGACTATTTCAGTTTCAG -3'

Sequencing Primer
(F):5'- CCCTGCTGTGTTGAAAGGGAAC -3'
(R):5'- AGCTAGCTTGCCATCTCA -3'
Posted On2016-12-15