Incidental Mutation 'R5793:Ttc23l'
ID447094
Institutional Source Beutler Lab
Gene Symbol Ttc23l
Ensembl Gene ENSMUSG00000022249
Gene Nametetratricopeptide repeat domain 23-like
Synonyms4930401A09Rik
MMRRC Submission 043208-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R5793 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location10500102-10558668 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 10551550 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 30 (T30K)
Ref Sequence ENSEMBL: ENSMUSP00000131180 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022857] [ENSMUST00000166039] [ENSMUST00000167842] [ENSMUST00000167842]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022857
AA Change: T30K

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000022857
Gene: ENSMUSG00000022249
AA Change: T30K

DomainStartEndE-ValueType
TPR 159 192 4.21e1 SMART
Blast:TPR 208 239 2e-6 BLAST
TPR 250 283 1.4e1 SMART
low complexity region 292 303 N/A INTRINSIC
TPR 376 409 9.53e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166039
SMART Domains Protein: ENSMUSP00000131180
Gene: ENSMUSG00000022249

DomainStartEndE-ValueType
Blast:TPR 183 209 9e-11 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000167842
AA Change: T30K

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000127781
Gene: ENSMUSG00000022249
AA Change: T30K

DomainStartEndE-ValueType
low complexity region 18 29 N/A INTRINSIC
Pfam:TPR_1 102 133 3.3e-6 PFAM
low complexity region 148 160 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000167842
AA Change: T30K

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
Meta Mutation Damage Score 0.146 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alox12 C A 11: 70,243,053 R522L probably benign Het
Arfgef1 A T 1: 10,209,528 D271E probably benign Het
Arg1 C T 10: 24,920,642 V96M probably benign Het
Arhgap8 T A 15: 84,772,022 M408K probably benign Het
Axin1 T C 17: 26,143,308 S209P probably damaging Het
B4galnt3 A G 6: 120,208,904 probably null Het
BC025446 T C 15: 75,221,644 S122P probably benign Het
BC067074 G T 13: 113,321,022 V1201L possibly damaging Het
Cdh23 T A 10: 60,306,128 D3058V probably damaging Het
Chd9 A G 8: 91,001,756 T794A probably damaging Het
Ckap5 C T 2: 91,619,835 T1891I possibly damaging Het
Dzank1 T C 2: 144,506,224 I207M probably benign Het
Fkbp9 G A 6: 56,873,513 probably null Het
Gm4781 T A 10: 100,396,667 K136* noncoding transcript Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Gtpbp6 G A 5: 110,107,228 L33F probably benign Het
Hsd11b1 A C 1: 193,242,184 F27V probably damaging Het
Ift172 A T 5: 31,276,948 I482N possibly damaging Het
Kcnma1 C T 14: 23,309,035 V1048I probably null Het
Myh9 T C 15: 77,768,877 Q1420R probably benign Het
Ncam2 G A 16: 81,576,103 V569I possibly damaging Het
Nsd1 T C 13: 55,248,006 V1243A probably benign Het
Ogdhl T A 14: 32,332,773 L226Q probably damaging Het
Olfr645 T C 7: 104,085,030 T17A probably benign Het
Orc2 T C 1: 58,497,388 M1V probably null Het
Padi2 T C 4: 140,933,190 L327P probably benign Het
Palb2 T C 7: 122,127,637 N337D probably benign Het
Pard3b A T 1: 61,767,973 H49L probably damaging Het
Pigz T C 16: 31,945,467 S448P probably benign Het
Ppfia4 A G 1: 134,312,106 V911A probably damaging Het
Qser1 T C 2: 104,762,860 Y1604C probably damaging Het
Rpgrip1l A G 8: 91,260,772 S886P probably benign Het
Sdk2 T C 11: 113,868,952 I408V possibly damaging Het
Sema7a A T 9: 57,960,257 R431W probably damaging Het
Slc22a30 T A 19: 8,336,819 Y501F possibly damaging Het
Slitrk5 T A 14: 111,679,913 V323D probably damaging Het
Snap47 C T 11: 59,438,192 E95K probably damaging Het
Tbc1d9 A T 8: 83,271,440 I1209F probably damaging Het
Tek T A 4: 94,820,096 M297K probably benign Het
Tmem132e T A 11: 82,444,858 I922N probably damaging Het
Tmx2 T C 2: 84,676,157 R64G probably damaging Het
Trim68 A T 7: 102,684,353 S41T possibly damaging Het
Tsga10 A T 1: 37,835,459 M115K probably damaging Het
Vmn2r84 C T 10: 130,385,885 C822Y probably damaging Het
Wdr72 C T 9: 74,210,343 A791V probably benign Het
Zfp580 A T 7: 5,052,892 T26S probably benign Het
Zfp772 G A 7: 7,204,284 T136I probably benign Het
Other mutations in Ttc23l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01143:Ttc23l APN 15 10530689 missense probably damaging 1.00
IGL01319:Ttc23l APN 15 10509406 unclassified probably benign
IGL01562:Ttc23l APN 15 10551390 unclassified probably benign
IGL01969:Ttc23l APN 15 10551434 nonsense probably null
IGL03172:Ttc23l APN 15 10537566 missense probably benign 0.06
R0042:Ttc23l UTSW 15 10551541 missense probably damaging 1.00
R0042:Ttc23l UTSW 15 10551541 missense probably damaging 1.00
R0335:Ttc23l UTSW 15 10539963 missense probably benign 0.26
R0554:Ttc23l UTSW 15 10530657 missense probably benign 0.12
R0609:Ttc23l UTSW 15 10504536 missense probably benign
R0631:Ttc23l UTSW 15 10539980 missense probably damaging 1.00
R1703:Ttc23l UTSW 15 10523658 missense probably damaging 1.00
R2106:Ttc23l UTSW 15 10547256 missense probably damaging 1.00
R2220:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R2276:Ttc23l UTSW 15 10523592 missense possibly damaging 0.92
R2277:Ttc23l UTSW 15 10523592 missense possibly damaging 0.92
R2278:Ttc23l UTSW 15 10523592 missense possibly damaging 0.92
R2279:Ttc23l UTSW 15 10523592 missense possibly damaging 0.92
R2368:Ttc23l UTSW 15 10537562 small insertion probably benign
R2368:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R2420:Ttc23l UTSW 15 10537562 small insertion probably benign
R2420:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R2421:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R2422:Ttc23l UTSW 15 10537562 small insertion probably benign
R2422:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R2830:Ttc23l UTSW 15 10537562 small insertion probably benign
R2831:Ttc23l UTSW 15 10537562 small insertion probably benign
R2831:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R2979:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R2980:Ttc23l UTSW 15 10537562 small insertion probably benign
R2980:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R2981:Ttc23l UTSW 15 10537562 small insertion probably benign
R2981:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R2982:Ttc23l UTSW 15 10537562 small insertion probably benign
R2982:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R2983:Ttc23l UTSW 15 10537562 small insertion probably benign
R2983:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R3176:Ttc23l UTSW 15 10547232 missense possibly damaging 0.83
R3177:Ttc23l UTSW 15 10547232 missense possibly damaging 0.83
R3276:Ttc23l UTSW 15 10547232 missense possibly damaging 0.83
R3277:Ttc23l UTSW 15 10547232 missense possibly damaging 0.83
R3722:Ttc23l UTSW 15 10537562 small insertion probably benign
R3722:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R3743:Ttc23l UTSW 15 10537562 small insertion probably benign
R3743:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R3767:Ttc23l UTSW 15 10530695 missense possibly damaging 0.94
R3921:Ttc23l UTSW 15 10537562 small insertion probably benign
R3921:Ttc23l UTSW 15 10537563 small insertion probably benign
R3921:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R4091:Ttc23l UTSW 15 10537562 small insertion probably benign
R4091:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R4119:Ttc23l UTSW 15 10539920 missense probably damaging 1.00
R4120:Ttc23l UTSW 15 10539920 missense probably damaging 1.00
R4373:Ttc23l UTSW 15 10537562 small insertion probably benign
R4373:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R4375:Ttc23l UTSW 15 10537562 small insertion probably benign
R4375:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R4376:Ttc23l UTSW 15 10537562 small insertion probably benign
R4376:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R4377:Ttc23l UTSW 15 10537562 small insertion probably benign
R4377:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R5002:Ttc23l UTSW 15 10551550 missense possibly damaging 0.95
R5106:Ttc23l UTSW 15 10551550 missense possibly damaging 0.95
R5107:Ttc23l UTSW 15 10551550 missense possibly damaging 0.95
R5109:Ttc23l UTSW 15 10551550 missense possibly damaging 0.95
R5156:Ttc23l UTSW 15 10551550 missense possibly damaging 0.95
R5157:Ttc23l UTSW 15 10551550 missense possibly damaging 0.95
R5160:Ttc23l UTSW 15 10551550 missense possibly damaging 0.95
R5161:Ttc23l UTSW 15 10551550 missense possibly damaging 0.95
R5259:Ttc23l UTSW 15 10515150 missense probably damaging 0.99
R5307:Ttc23l UTSW 15 10533659 missense probably damaging 1.00
R5728:Ttc23l UTSW 15 10551550 missense possibly damaging 0.95
R5756:Ttc23l UTSW 15 10551550 missense possibly damaging 0.95
R5772:Ttc23l UTSW 15 10551469 missense probably benign 0.01
R5794:Ttc23l UTSW 15 10551550 missense possibly damaging 0.95
R5847:Ttc23l UTSW 15 10537596 missense probably benign 0.07
Z1088:Ttc23l UTSW 15 10533667 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGCATGCTTTCAAATGACAACC -3'
(R):5'- CCACACTGCTGGCTTAGAAG -3'

Sequencing Primer
(F):5'- TGCTTTCAAATGACAACCTGAAC -3'
(R):5'- CTTAGAAGCTAGGTCTTGAGAGTAG -3'
Posted OnDec 15, 2016