Incidental Mutation 'R0544:Pkd1'
ID44723
Institutional Source Beutler Lab
Gene Symbol Pkd1
Ensembl Gene ENSMUSG00000032855
Gene Namepolycystin 1, transient receptor poteintial channel interacting
SynonymsPC-1, polycystin-1, PC1
MMRRC Submission 038736-MU
Accession Numbers

Ncbi RefSeq: NM_013630.2; MGI:97603

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0544 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location24549834-24596508 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 24585683 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 790 (T790I)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035565]
Predicted Effect probably damaging
Transcript: ENSMUST00000035565
AA Change: T3127I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000049296
Gene: ENSMUSG00000032855
AA Change: T3127I

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
LRRNT 32 71 1.61e-8 SMART
LRR_TYP 90 113 2.47e-5 SMART
LRRCT 125 177 3.84e-12 SMART
WSC 177 271 6.93e-34 SMART
PKD 272 355 2.72e-15 SMART
CLECT 406 530 5.72e-20 SMART
low complexity region 545 558 N/A INTRINSIC
low complexity region 763 788 N/A INTRINSIC
PKD 930 1008 1.06e-8 SMART
PKD 1015 1119 2.26e-12 SMART
PKD 1122 1205 2.03e-14 SMART
PKD 1208 1288 1.14e-17 SMART
PKD 1290 1373 2.35e-10 SMART
PKD 1374 1459 7.63e-10 SMART
PKD 1464 1541 1.95e-16 SMART
PKD 1544 1625 1.05e-16 SMART
PKD 1631 1714 1.93e-1 SMART
PKD 1716 1798 2.21e-15 SMART
PKD 1799 1882 5.7e-9 SMART
PKD 1884 1964 1.56e-6 SMART
PKD 1968 2056 3.1e-10 SMART
PKD 2057 2140 1.74e-13 SMART
Pfam:REJ 2167 2610 1e-108 PFAM
low complexity region 2697 2706 N/A INTRINSIC
GPS 3003 3052 1.33e-12 SMART
transmembrane domain 3065 3087 N/A INTRINSIC
LH2 3110 3224 3.5e-18 SMART
transmembrane domain 3275 3294 N/A INTRINSIC
transmembrane domain 3314 3336 N/A INTRINSIC
low complexity region 3357 3378 N/A INTRINSIC
low complexity region 3479 3492 N/A INTRINSIC
transmembrane domain 3547 3569 N/A INTRINSIC
low complexity region 3573 3591 N/A INTRINSIC
low complexity region 3626 3639 N/A INTRINSIC
low complexity region 3661 3676 N/A INTRINSIC
Pfam:PKD_channel 3701 4103 7.1e-125 PFAM
low complexity region 4153 4172 N/A INTRINSIC
low complexity region 4238 4256 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226178
Predicted Effect probably damaging
Transcript: ENSMUST00000227107
AA Change: T790I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000227836
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228750
Meta Mutation Damage Score 0.1088 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 98% (97/99)
MGI Phenotype Strain: Several; see below
Lethality: E13-E15
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the polycystin protein family. The encoded glycoprotein contains a large N-terminal extracellular region, multiple transmembrane domains and a cytoplasmic C-tail. It is an integral membrane protein that functions as a regulator of calcium permeable cation channels and intracellular calcium homoeostasis. It is also involved in cell-cell/matrix interactions and may modulate G-protein-coupled signal-transduction pathways. It plays a role in renal tubular development, and mutations in this gene cause autosomal dominant polycystic kidney disease type 1 (ADPKD1). ADPKD1 is characterized by the growth of fluid-filled cysts that replace normal renal tissue and result in end-stage renal failure. Splice variants encoding different isoforms have been noted for this gene. Also, six pseudogenes, closely linked in a known duplicated region on chromosome 16p, have been described. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygous mutant embryos begin to die after embryonic day (E) 14.5. They develop edema by E13.5, pancreatic cysts by E15.5 and kidney cysts by E16.5. Heterozygous adults develop cysts of the kidneys (~20-30%) and the liver (~10%) late in life. [provided by MGI curators]
Allele List at MGI

All alleles(32) : Targeted(28) Gene trapped(3) Chemically induced(1)

Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930012K11Rik A T 14: 70,157,314 F130L probably benign Het
Aatf C T 11: 84,423,005 R511Q probably benign Het
Acot12 A T 13: 91,784,656 D516V probably benign Het
Adgrb2 T C 4: 130,017,542 V1207A probably damaging Het
Akap9 A G 5: 4,069,185 D3564G probably benign Het
Arl8b C T 6: 108,783,228 probably benign Het
Atf6b T C 17: 34,648,299 probably null Het
Atrn G A 2: 130,986,826 G1097D probably damaging Het
Btbd6 A G 12: 112,977,082 E61G probably damaging Het
Car15 A G 16: 17,835,816 probably benign Het
Car5b G A X: 163,979,301 R282C probably damaging Het
Carmil2 C T 8: 105,691,235 A654V probably damaging Het
Cbwd1 A G 19: 24,949,211 Y159H possibly damaging Het
Ccdc88b A G 19: 6,857,266 L124P probably damaging Het
Ccnd1 A G 7: 144,937,286 probably benign Het
Cd3eap G T 7: 19,359,141 P38Q probably damaging Het
Cenph A G 13: 100,772,741 S53P probably damaging Het
Chrm3 T A 13: 9,877,579 I474F probably damaging Het
Cln8 T A 8: 14,896,769 V261E probably benign Het
Coa6 A G 8: 126,422,760 D25G probably benign Het
Col4a1 T G 8: 11,226,487 probably benign Het
Cpxm1 T C 2: 130,393,135 H588R probably damaging Het
Cul7 T C 17: 46,663,544 L1516P possibly damaging Het
Dcdc5 A G 2: 106,351,564 noncoding transcript Het
Ddx5 T C 11: 106,782,462 probably benign Het
Dhx16 C A 17: 35,881,659 P161Q probably benign Het
Dpy19l1 A T 9: 24,485,110 probably benign Het
Fastkd5 A G 2: 130,615,296 V458A probably damaging Het
Fhit A G 14: 9,870,172 V99A probably damaging Het
Fndc3a A T 14: 72,557,622 probably benign Het
Foxd4 A T 19: 24,899,818 S339R possibly damaging Het
Gm10842 T A 11: 105,147,054 D54E unknown Het
Gns T A 10: 121,376,267 Y94* probably null Het
Gp2 A G 7: 119,454,496 W81R probably benign Het
Hdac5 T G 11: 102,196,096 Q46P probably damaging Het
Homer2 A C 7: 81,649,678 V13G probably damaging Het
Irs3 A G 5: 137,643,839 S446P probably benign Het
Ism2 G T 12: 87,285,339 D141E probably damaging Het
Jak1 T A 4: 101,191,625 M19L probably benign Het
Kcnd3 C A 3: 105,658,759 R419S probably damaging Het
Lamb1 T C 12: 31,282,695 F272S probably damaging Het
Ldlrad2 T G 4: 137,572,268 T82P possibly damaging Het
Lrp2 T C 2: 69,491,931 K1885E probably benign Het
Mbd5 T C 2: 49,257,209 V477A possibly damaging Het
Mrps33 A T 6: 39,805,554 M11K possibly damaging Het
Mylk G C 16: 34,879,475 E403Q possibly damaging Het
Myom2 T A 8: 15,069,796 V184E probably damaging Het
Ncor1 C A 11: 62,333,776 G1210V probably damaging Het
Ncor1 C T 11: 62,333,777 G1210R probably damaging Het
Nlrp4a A G 7: 26,457,130 D760G probably benign Het
Noc4l A G 5: 110,651,123 V231A possibly damaging Het
Olfr1056 T C 2: 86,355,663 T240A probably damaging Het
Olfr1217 T C 2: 89,023,826 Y59C probably damaging Het
Olfr1306 A T 2: 111,912,560 Y123* probably null Het
Olfr1450 A G 19: 12,953,702 T38A possibly damaging Het
Olfr193 T A 16: 59,110,225 K128N probably benign Het
Olfr521 T C 7: 99,767,660 I166T probably benign Het
Olfr598 T A 7: 103,328,651 I55N probably damaging Het
Olfr733 A T 14: 50,298,682 V209E probably benign Het
Padi4 GCTGCGTACCTCCAC GC 4: 140,748,449 probably benign Het
Patj T A 4: 98,569,110 M1283K probably damaging Het
Plod3 C A 5: 136,991,611 T526K probably benign Het
Plxnb2 C A 15: 89,158,613 probably benign Het
Pramel1 T A 4: 143,397,605 D283E possibly damaging Het
Prpf40a T C 2: 53,141,651 probably benign Het
Psg23 A T 7: 18,614,682 Y67N probably damaging Het
Rftn1 T A 17: 49,994,261 Q242L possibly damaging Het
Rp1l1 A T 14: 64,032,066 E1700D probably benign Het
Scube3 T C 17: 28,164,153 F435S probably damaging Het
Sdk2 T C 11: 113,781,010 Y2104C probably damaging Het
Sept11 A G 5: 93,165,368 E358G possibly damaging Het
Sh3bp1 T C 15: 78,905,775 L246P probably damaging Het
Sis T C 3: 72,951,642 Y352C probably damaging Het
Skint1 T C 4: 112,021,365 S165P probably damaging Het
Skint10 C T 4: 112,728,811 probably benign Het
Slc1a2 A T 2: 102,756,072 R340S probably damaging Het
Slc26a3 C A 12: 31,447,740 Q48K probably benign Het
Slc5a2 A T 7: 128,269,999 Y317F probably damaging Het
Sorbs3 T A 14: 70,193,926 T262S probably benign Het
Tas2r118 G T 6: 23,969,401 S220R probably damaging Het
Terf2ip C A 8: 112,015,342 Q223K possibly damaging Het
Tespa1 A G 10: 130,360,811 Q206R probably damaging Het
Tex10 T C 4: 48,462,766 probably null Het
Tle1 T A 4: 72,124,990 K547N probably damaging Het
Tmem131l T A 3: 83,898,546 Q1530L probably damaging Het
Tomm20l A G 12: 71,123,077 E145G possibly damaging Het
Tra2a C T 6: 49,250,951 probably benign Het
Trim32 G A 4: 65,613,254 R16Q probably damaging Het
Trim37 T A 11: 87,145,502 Y121* probably null Het
Tube1 C T 10: 39,140,945 probably null Het
Usp6nl T A 2: 6,421,009 V187D probably damaging Het
Vmn1r13 T C 6: 57,210,263 F136L probably benign Het
Vmn1r201 A T 13: 22,475,146 I177F probably benign Het
Vmn1r203 A T 13: 22,524,273 T75S possibly damaging Het
Vmn1r225 C T 17: 20,502,456 S53L probably benign Het
Xab2 A T 8: 3,610,994 W707R probably damaging Het
Zfp808 T C 13: 62,169,434 probably benign Het
Other mutations in Pkd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Pkd1 APN 17 24580095 missense probably damaging 1.00
IGL00503:Pkd1 APN 17 24565427 missense probably benign
IGL00549:Pkd1 APN 17 24572761 missense probably benign
IGL00573:Pkd1 APN 17 24594530 nonsense probably null
IGL00924:Pkd1 APN 17 24571627 nonsense probably null
IGL01319:Pkd1 APN 17 24587919 unclassified probably benign
IGL01326:Pkd1 APN 17 24576174 nonsense probably null
IGL01457:Pkd1 APN 17 24594821 unclassified probably null
IGL01541:Pkd1 APN 17 24586298 missense probably damaging 1.00
IGL01575:Pkd1 APN 17 24573128 missense probably damaging 1.00
IGL01606:Pkd1 APN 17 24576523 missense probably damaging 0.97
IGL01642:Pkd1 APN 17 24581292 missense probably damaging 1.00
IGL01888:Pkd1 APN 17 24585815 missense possibly damaging 0.91
IGL01940:Pkd1 APN 17 24579746 missense possibly damaging 0.63
IGL01958:Pkd1 APN 17 24580324 missense probably damaging 1.00
IGL02005:Pkd1 APN 17 24586004 missense possibly damaging 0.67
IGL02121:Pkd1 APN 17 24575927 missense probably benign 0.03
IGL02148:Pkd1 APN 17 24579836 missense probably damaging 1.00
IGL02409:Pkd1 APN 17 24573623 missense probably benign 0.01
IGL02442:Pkd1 APN 17 24565226 missense probably benign 0.41
IGL02498:Pkd1 APN 17 24585779 missense possibly damaging 0.91
IGL02501:Pkd1 APN 17 24569699 missense probably benign 0.01
IGL02551:Pkd1 APN 17 24573815 missense probably damaging 1.00
IGL02635:Pkd1 APN 17 24572811 missense probably damaging 1.00
IGL02673:Pkd1 APN 17 24571283 missense probably benign 0.40
IGL02808:Pkd1 APN 17 24593504 missense probably damaging 1.00
IGL02816:Pkd1 APN 17 24594515 missense probably benign 0.00
IGL02863:Pkd1 APN 17 24569752 missense possibly damaging 0.56
IGL02927:Pkd1 APN 17 24575189 missense probably damaging 1.00
IGL02961:Pkd1 APN 17 24578115 missense possibly damaging 0.81
IGL03003:Pkd1 APN 17 24593603 critical splice donor site probably null
IGL03066:Pkd1 APN 17 24586234 missense probably damaging 1.00
IGL03182:Pkd1 APN 17 24573818 missense probably damaging 0.98
IGL03384:Pkd1 APN 17 24565897 missense probably benign 0.00
IGL03404:Pkd1 APN 17 24564406 missense probably damaging 0.97
PIT1430001:Pkd1 UTSW 17 24569511 missense probably damaging 0.99
PIT4494001:Pkd1 UTSW 17 24577801 missense probably damaging 1.00
PIT4677001:Pkd1 UTSW 17 24574029 missense possibly damaging 0.94
R0017:Pkd1 UTSW 17 24578539 critical splice donor site probably null
R0017:Pkd1 UTSW 17 24578539 critical splice donor site probably null
R0022:Pkd1 UTSW 17 24594819 missense probably damaging 0.98
R0022:Pkd1 UTSW 17 24594819 missense probably damaging 0.98
R0058:Pkd1 UTSW 17 24564703 missense probably benign 0.06
R0058:Pkd1 UTSW 17 24564703 missense probably benign 0.06
R0085:Pkd1 UTSW 17 24586223 missense probably damaging 0.98
R0094:Pkd1 UTSW 17 24581276 missense possibly damaging 0.80
R0094:Pkd1 UTSW 17 24581276 missense possibly damaging 0.80
R0135:Pkd1 UTSW 17 24565071 missense possibly damaging 0.85
R0304:Pkd1 UTSW 17 24585946 missense probably damaging 1.00
R0427:Pkd1 UTSW 17 24593502 missense probably damaging 0.98
R0502:Pkd1 UTSW 17 24574792 missense probably damaging 0.99
R0518:Pkd1 UTSW 17 24595219 missense probably benign 0.01
R0521:Pkd1 UTSW 17 24595219 missense probably benign 0.01
R0546:Pkd1 UTSW 17 24580138 missense probably benign 0.44
R0626:Pkd1 UTSW 17 24575575 missense probably damaging 0.96
R0648:Pkd1 UTSW 17 24594937 missense probably damaging 1.00
R1138:Pkd1 UTSW 17 24586032 missense probably damaging 1.00
R1302:Pkd1 UTSW 17 24568236 missense probably benign 0.00
R1306:Pkd1 UTSW 17 24573172 missense probably damaging 0.97
R1349:Pkd1 UTSW 17 24575266 missense probably damaging 1.00
R1372:Pkd1 UTSW 17 24575266 missense probably damaging 1.00
R1437:Pkd1 UTSW 17 24595132 missense probably damaging 1.00
R1515:Pkd1 UTSW 17 24594853 missense probably benign 0.01
R1605:Pkd1 UTSW 17 24577526 missense possibly damaging 0.95
R1622:Pkd1 UTSW 17 24581640 missense probably benign
R1623:Pkd1 UTSW 17 24578269 missense probably damaging 0.99
R1726:Pkd1 UTSW 17 24564176 missense probably damaging 0.96
R1756:Pkd1 UTSW 17 24594485 missense probably damaging 1.00
R1780:Pkd1 UTSW 17 24581569 missense probably benign
R1785:Pkd1 UTSW 17 24591099 missense probably benign 0.00
R1829:Pkd1 UTSW 17 24565584 missense probably benign
R1869:Pkd1 UTSW 17 24594931 missense probably damaging 1.00
R1920:Pkd1 UTSW 17 24595157 missense probably damaging 0.99
R1922:Pkd1 UTSW 17 24595157 missense probably damaging 0.99
R1987:Pkd1 UTSW 17 24576592 splice site probably null
R1988:Pkd1 UTSW 17 24576592 splice site probably null
R1998:Pkd1 UTSW 17 24573014 missense probably damaging 1.00
R2007:Pkd1 UTSW 17 24579785 missense probably damaging 1.00
R2019:Pkd1 UTSW 17 24568684 nonsense probably null
R2054:Pkd1 UTSW 17 24574796 missense probably benign 0.00
R2061:Pkd1 UTSW 17 24569914 missense possibly damaging 0.89
R2196:Pkd1 UTSW 17 24580072 missense possibly damaging 0.60
R2203:Pkd1 UTSW 17 24580889 missense probably benign 0.01
R2301:Pkd1 UTSW 17 24574612 missense probably benign
R2655:Pkd1 UTSW 17 24576490 missense probably damaging 0.99
R2860:Pkd1 UTSW 17 24565446 missense probably benign 0.43
R2861:Pkd1 UTSW 17 24565446 missense probably benign 0.43
R3000:Pkd1 UTSW 17 24594486 missense probably damaging 1.00
R3150:Pkd1 UTSW 17 24579791 missense probably benign 0.00
R3747:Pkd1 UTSW 17 24591461 missense possibly damaging 0.67
R3812:Pkd1 UTSW 17 24565641 missense probably benign 0.00
R3859:Pkd1 UTSW 17 24578092 splice site probably benign
R3893:Pkd1 UTSW 17 24572110 critical splice donor site probably null
R3947:Pkd1 UTSW 17 24578037 splice site probably benign
R3949:Pkd1 UTSW 17 24578037 splice site probably benign
R4176:Pkd1 UTSW 17 24587997 missense probably benign 0.17
R4199:Pkd1 UTSW 17 24570030 missense probably benign 0.41
R4225:Pkd1 UTSW 17 24593523 missense possibly damaging 0.50
R4439:Pkd1 UTSW 17 24585692 missense probably damaging 1.00
R4476:Pkd1 UTSW 17 24576526 missense probably damaging 1.00
R4716:Pkd1 UTSW 17 24576133 missense probably damaging 1.00
R4801:Pkd1 UTSW 17 24578096 missense probably damaging 1.00
R4802:Pkd1 UTSW 17 24578096 missense probably damaging 1.00
R4817:Pkd1 UTSW 17 24565374 unclassified probably null
R4903:Pkd1 UTSW 17 24572002 missense probably benign 0.30
R4910:Pkd1 UTSW 17 24572687 missense probably damaging 1.00
R4964:Pkd1 UTSW 17 24586068 critical splice donor site probably null
R4966:Pkd1 UTSW 17 24586068 critical splice donor site probably null
R5040:Pkd1 UTSW 17 24571260 missense probably benign 0.02
R5042:Pkd1 UTSW 17 24569887 missense probably benign 0.00
R5088:Pkd1 UTSW 17 24590838 missense possibly damaging 0.94
R5121:Pkd1 UTSW 17 24573463 missense probably benign
R5296:Pkd1 UTSW 17 24576074 missense probably damaging 1.00
R5338:Pkd1 UTSW 17 24594536 missense probably benign
R5356:Pkd1 UTSW 17 24593577 missense probably damaging 0.97
R5357:Pkd1 UTSW 17 24565790 missense probably damaging 1.00
R5363:Pkd1 UTSW 17 24565073 missense probably benign
R5383:Pkd1 UTSW 17 24574375 missense probably benign
R5622:Pkd1 UTSW 17 24574040 missense possibly damaging 0.67
R5651:Pkd1 UTSW 17 24591387 missense possibly damaging 0.88
R5664:Pkd1 UTSW 17 24569371 missense probably damaging 0.99
R5723:Pkd1 UTSW 17 24565523 missense probably benign 0.01
R5797:Pkd1 UTSW 17 24592641 missense possibly damaging 0.55
R5838:Pkd1 UTSW 17 24580212 missense possibly damaging 0.75
R5866:Pkd1 UTSW 17 24580961 missense probably damaging 0.99
R5873:Pkd1 UTSW 17 24569830 missense probably benign
R5906:Pkd1 UTSW 17 24572920 missense probably benign 0.16
R6047:Pkd1 UTSW 17 24595085 missense probably damaging 1.00
R6076:Pkd1 UTSW 17 24581030 missense probably benign 0.14
R6151:Pkd1 UTSW 17 24575606 missense probably benign 0.00
R6252:Pkd1 UTSW 17 24581226 missense probably damaging 0.98
R6341:Pkd1 UTSW 17 24580227 missense probably damaging 1.00
R6540:Pkd1 UTSW 17 24575977 missense probably damaging 1.00
R6732:Pkd1 UTSW 17 24569413 missense probably damaging 1.00
R6836:Pkd1 UTSW 17 24581259 missense probably damaging 1.00
R6856:Pkd1 UTSW 17 24573493 missense probably benign 0.05
R6865:Pkd1 UTSW 17 24576487 missense probably benign 0.43
R6999:Pkd1 UTSW 17 24578501 missense possibly damaging 0.62
R7077:Pkd1 UTSW 17 24591119 missense probably damaging 1.00
R7123:Pkd1 UTSW 17 24594768 missense possibly damaging 0.89
R7134:Pkd1 UTSW 17 24594112 missense probably damaging 0.99
R7210:Pkd1 UTSW 17 24575866 missense probably damaging 0.98
R7323:Pkd1 UTSW 17 24575051 missense probably benign 0.01
X0024:Pkd1 UTSW 17 24591392 missense possibly damaging 0.68
X0061:Pkd1 UTSW 17 24594931 missense probably damaging 1.00
X0065:Pkd1 UTSW 17 24586164 missense probably benign 0.19
Z1088:Pkd1 UTSW 17 24565605 missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- TGTCACAAATTCAGGCAAGTGAGGG -3'
(R):5'- TAATGTGTTGCAGGAACCAGGCAGG -3'

Sequencing Primer
(F):5'- aggcaagtgagggcaaag -3'
(R):5'- CACCTCAGTGAGGACTGAAGC -3'
Posted On2013-06-11