Incidental Mutation 'R5797:Vmn2r12'
ID447267
Institutional Source Beutler Lab
Gene Symbol Vmn2r12
Ensembl Gene ENSMUSG00000090688
Gene Namevomeronasal 2, receptor 12
SynonymsGm6769
MMRRC Submission 043209-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R5797 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location109085849-109097864 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 109085870 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 825 (C825*)
Ref Sequence ENSEMBL: ENSMUSP00000093612 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095922]
Predicted Effect probably null
Transcript: ENSMUST00000095922
AA Change: C825*
SMART Domains Protein: ENSMUSP00000093612
Gene: ENSMUSG00000090688
AA Change: C825*

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 76 466 8.8e-30 PFAM
Pfam:NCD3G 505 559 1.7e-18 PFAM
Pfam:7tm_3 591 827 3.9e-54 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430573F11Rik A T 8: 36,498,415 K30* probably null Het
Abhd18 T C 3: 40,933,551 F277L probably benign Het
Acsf2 A G 11: 94,571,679 V170A probably damaging Het
Amz2 G T 11: 109,427,079 probably benign Het
Atp4a A G 7: 30,712,649 Y65C probably damaging Het
Canx T C 11: 50,301,017 I356V probably benign Het
Cfap54 T A 10: 92,967,576 T1535S probably benign Het
Cts3 A T 13: 61,568,392 W52R probably damaging Het
Cyb5rl A T 4: 107,084,207 E276D possibly damaging Het
Dhx30 T C 9: 110,098,820 N78S probably damaging Het
Dmap1 A T 4: 117,675,480 V333E possibly damaging Het
Dnah10 A G 5: 124,821,386 E3744G probably benign Het
Efcab6 C T 15: 83,924,277 C828Y possibly damaging Het
Fam227b A C 2: 126,007,334 I326S probably benign Het
Fbrs C A 7: 127,487,291 H604Q probably damaging Het
Fshr T G 17: 89,011,075 N129T probably damaging Het
Gja3 T C 14: 57,035,713 R401G probably damaging Het
Gm572 G A 4: 148,666,798 M209I probably benign Het
Gne G A 4: 44,060,030 T121M probably damaging Het
Gnmt T C 17: 46,726,379 N160D probably damaging Het
Kalrn T C 16: 34,212,249 Y1125C probably damaging Het
Kif2a A T 13: 106,975,376 C524S probably damaging Het
Kl A G 5: 150,991,538 N910S possibly damaging Het
Lrrtm2 C T 18: 35,213,706 R181H probably damaging Het
Mkln1 A G 6: 31,433,069 D214G probably benign Het
Muc5b C A 7: 141,851,582 T909N unknown Het
Myh13 T A 11: 67,335,002 D335E possibly damaging Het
Myo5b A G 18: 74,701,521 E884G probably benign Het
Naip1 T C 13: 100,444,526 D71G possibly damaging Het
Nxpe4 T A 9: 48,396,538 I314N possibly damaging Het
Pcnt T C 10: 76,392,756 E1525G probably benign Het
Pkd1 T A 17: 24,592,641 H153Q possibly damaging Het
Prkdc T A 16: 15,737,834 Y2157* probably null Het
Scd3 T C 19: 44,215,511 I46T probably benign Het
Sdha A T 13: 74,334,357 M279K probably damaging Het
Slco4c1 A G 1: 96,819,104 V671A probably benign Het
Slitrk3 T A 3: 73,048,629 T937S probably damaging Het
Sncaip A T 18: 52,898,204 T442S probably benign Het
Sptb T C 12: 76,603,699 D1748G possibly damaging Het
Other mutations in Vmn2r12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00948:Vmn2r12 APN 5 109097675 missense possibly damaging 0.47
IGL01096:Vmn2r12 APN 5 109086259 missense probably damaging 1.00
IGL01538:Vmn2r12 APN 5 109091850 missense probably damaging 1.00
IGL01548:Vmn2r12 APN 5 109093027 nonsense probably null
IGL01762:Vmn2r12 APN 5 109086564 missense probably damaging 0.99
IGL01860:Vmn2r12 APN 5 109092159 missense probably benign 0.10
IGL02269:Vmn2r12 APN 5 109086477 missense probably damaging 1.00
IGL02530:Vmn2r12 APN 5 109085992 missense probably damaging 1.00
IGL02887:Vmn2r12 APN 5 109090485 missense probably benign 0.03
IGL03265:Vmn2r12 APN 5 109092070 missense probably benign 0.05
R0396:Vmn2r12 UTSW 5 109092899 missense probably benign 0.00
R0497:Vmn2r12 UTSW 5 109091889 nonsense probably null
R0529:Vmn2r12 UTSW 5 109092848 missense probably benign
R0715:Vmn2r12 UTSW 5 109090507 missense probably benign 0.10
R0742:Vmn2r12 UTSW 5 109086415 missense possibly damaging 0.55
R0894:Vmn2r12 UTSW 5 109087850 critical splice donor site probably null
R1173:Vmn2r12 UTSW 5 109092854 missense probably benign 0.00
R1174:Vmn2r12 UTSW 5 109092854 missense probably benign 0.00
R1259:Vmn2r12 UTSW 5 109091897 missense probably damaging 0.97
R1349:Vmn2r12 UTSW 5 109086586 missense probably benign 0.00
R1388:Vmn2r12 UTSW 5 109092974 missense possibly damaging 0.56
R1549:Vmn2r12 UTSW 5 109092830 missense probably benign 0.06
R1766:Vmn2r12 UTSW 5 109092044 missense probably damaging 1.00
R1781:Vmn2r12 UTSW 5 109091728 missense probably benign 0.00
R1885:Vmn2r12 UTSW 5 109092076 missense probably damaging 1.00
R2159:Vmn2r12 UTSW 5 109091474 missense probably benign 0.02
R2420:Vmn2r12 UTSW 5 109086532 missense probably benign 0.39
R2421:Vmn2r12 UTSW 5 109086532 missense probably benign 0.39
R2422:Vmn2r12 UTSW 5 109086532 missense probably benign 0.39
R2937:Vmn2r12 UTSW 5 109091531 missense probably damaging 1.00
R2938:Vmn2r12 UTSW 5 109091531 missense probably damaging 1.00
R3898:Vmn2r12 UTSW 5 109090504 missense probably benign 0.02
R4061:Vmn2r12 UTSW 5 109092192 missense possibly damaging 0.95
R4063:Vmn2r12 UTSW 5 109092192 missense possibly damaging 0.95
R4090:Vmn2r12 UTSW 5 109091546 missense probably benign 0.06
R4297:Vmn2r12 UTSW 5 109091964 missense probably benign 0.12
R4298:Vmn2r12 UTSW 5 109091964 missense probably benign 0.12
R4299:Vmn2r12 UTSW 5 109091964 missense probably benign 0.12
R4304:Vmn2r12 UTSW 5 109086006 missense probably damaging 1.00
R4306:Vmn2r12 UTSW 5 109086006 missense probably damaging 1.00
R4307:Vmn2r12 UTSW 5 109086006 missense probably damaging 1.00
R4308:Vmn2r12 UTSW 5 109086006 missense probably damaging 1.00
R4594:Vmn2r12 UTSW 5 109086435 missense probably damaging 1.00
R4783:Vmn2r12 UTSW 5 109086513 missense probably damaging 1.00
R4900:Vmn2r12 UTSW 5 109092986 missense probably damaging 1.00
R4929:Vmn2r12 UTSW 5 109091678 missense probably damaging 1.00
R4974:Vmn2r12 UTSW 5 109091506 missense probably damaging 1.00
R5389:Vmn2r12 UTSW 5 109090395 missense probably benign 0.00
R5431:Vmn2r12 UTSW 5 109091818 missense probably damaging 0.99
R5527:Vmn2r12 UTSW 5 109086617 nonsense probably null
R5639:Vmn2r12 UTSW 5 109092800 missense probably benign 0.06
R5753:Vmn2r12 UTSW 5 109091804 missense probably damaging 1.00
R6142:Vmn2r12 UTSW 5 109092897 missense probably benign
R6162:Vmn2r12 UTSW 5 109086564 missense probably damaging 0.99
R6176:Vmn2r12 UTSW 5 109086000 missense probably benign 0.43
R6853:Vmn2r12 UTSW 5 109092905 missense probably damaging 1.00
R7238:Vmn2r12 UTSW 5 109097789 missense possibly damaging 0.81
R7341:Vmn2r12 UTSW 5 109086247 missense possibly damaging 0.74
R7341:Vmn2r12 UTSW 5 109091945 missense possibly damaging 0.95
R7383:Vmn2r12 UTSW 5 109092818 missense probably benign 0.19
Z1088:Vmn2r12 UTSW 5 109092780 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGAAGTACTGTGCTGCTGTAC -3'
(R):5'- GGCTTTCTTGGCTAGGAACCTTC -3'

Sequencing Primer
(F):5'- GCTGTACAGTGTAAGTACTAACTTTG -3'
(R):5'- GGAACCTTCCTGACAGATTCAATG -3'
Posted On2016-12-15