Incidental Mutation 'R5798:Arhgef40'
ID447321
Institutional Source Beutler Lab
Gene Symbol Arhgef40
Ensembl Gene ENSMUSG00000004562
Gene NameRho guanine nucleotide exchange factor (GEF) 40
SynonymsE130112L23Rik
MMRRC Submission 043210-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.153) question?
Stock #R5798 (G1)
Quality Score216
Status Not validated
Chromosome14
Chromosomal Location51984719-52006251 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 51997032 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 931 (A931S)
Ref Sequence ENSEMBL: ENSMUSP00000138635 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093813] [ENSMUST00000100639] [ENSMUST00000182061] [ENSMUST00000182760] [ENSMUST00000182905] [ENSMUST00000182909] [ENSMUST00000183208]
Predicted Effect probably damaging
Transcript: ENSMUST00000093813
AA Change: A931S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000091331
Gene: ENSMUSG00000004562
AA Change: A931S

DomainStartEndE-ValueType
low complexity region 201 223 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 351 395 N/A INTRINSIC
low complexity region 451 472 N/A INTRINSIC
low complexity region 550 564 N/A INTRINSIC
low complexity region 581 606 N/A INTRINSIC
low complexity region 773 792 N/A INTRINSIC
low complexity region 885 914 N/A INTRINSIC
low complexity region 958 996 N/A INTRINSIC
Pfam:RhoGEF 1087 1246 6.1e-9 PFAM
PH 1264 1372 3.97e-8 SMART
low complexity region 1403 1424 N/A INTRINSIC
low complexity region 1478 1491 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000100639
AA Change: A931S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000098204
Gene: ENSMUSG00000004562
AA Change: A931S

DomainStartEndE-ValueType
low complexity region 201 223 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 351 395 N/A INTRINSIC
low complexity region 451 472 N/A INTRINSIC
low complexity region 550 564 N/A INTRINSIC
low complexity region 581 606 N/A INTRINSIC
low complexity region 773 792 N/A INTRINSIC
low complexity region 885 914 N/A INTRINSIC
low complexity region 958 996 N/A INTRINSIC
Pfam:RhoGEF 1087 1246 5.9e-9 PFAM
PH 1264 1372 3.97e-8 SMART
low complexity region 1430 1443 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182019
Predicted Effect probably damaging
Transcript: ENSMUST00000182061
AA Change: A931S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000138128
Gene: ENSMUSG00000004562
AA Change: A931S

DomainStartEndE-ValueType
low complexity region 201 223 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 351 395 N/A INTRINSIC
low complexity region 451 472 N/A INTRINSIC
low complexity region 550 564 N/A INTRINSIC
low complexity region 581 606 N/A INTRINSIC
low complexity region 773 792 N/A INTRINSIC
low complexity region 885 914 N/A INTRINSIC
low complexity region 958 996 N/A INTRINSIC
Pfam:RhoGEF 1087 1247 3.7e-9 PFAM
PH 1264 1372 3.97e-8 SMART
low complexity region 1430 1443 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182412
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182480
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182644
Predicted Effect probably damaging
Transcript: ENSMUST00000182760
AA Change: A940S

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000138125
Gene: ENSMUSG00000004562
AA Change: A940S

DomainStartEndE-ValueType
low complexity region 201 223 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 351 395 N/A INTRINSIC
low complexity region 451 472 N/A INTRINSIC
low complexity region 550 564 N/A INTRINSIC
low complexity region 581 606 N/A INTRINSIC
low complexity region 782 801 N/A INTRINSIC
low complexity region 894 923 N/A INTRINSIC
low complexity region 967 1005 N/A INTRINSIC
Pfam:RhoGEF 1096 1256 5.9e-9 PFAM
PH 1273 1381 3.97e-8 SMART
low complexity region 1412 1433 N/A INTRINSIC
low complexity region 1487 1500 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000182905
AA Change: A931S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000138797
Gene: ENSMUSG00000004562
AA Change: A931S

DomainStartEndE-ValueType
low complexity region 201 223 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 351 395 N/A INTRINSIC
low complexity region 451 472 N/A INTRINSIC
low complexity region 550 564 N/A INTRINSIC
low complexity region 581 606 N/A INTRINSIC
low complexity region 773 792 N/A INTRINSIC
low complexity region 885 914 N/A INTRINSIC
low complexity region 958 996 N/A INTRINSIC
SCOP:d1kz7a1 1073 1162 4e-7 SMART
Blast:RhoGEF 1087 1157 1e-8 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000182909
AA Change: A931S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000138635
Gene: ENSMUSG00000004562
AA Change: A931S

DomainStartEndE-ValueType
low complexity region 201 223 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 351 395 N/A INTRINSIC
low complexity region 451 472 N/A INTRINSIC
low complexity region 550 564 N/A INTRINSIC
low complexity region 581 606 N/A INTRINSIC
low complexity region 773 792 N/A INTRINSIC
low complexity region 885 914 N/A INTRINSIC
low complexity region 958 996 N/A INTRINSIC
Pfam:RhoGEF 1087 1247 3.9e-9 PFAM
PH 1264 1372 3.97e-8 SMART
low complexity region 1403 1424 N/A INTRINSIC
low complexity region 1478 1491 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183167
Predicted Effect probably benign
Transcript: ENSMUST00000183208
SMART Domains Protein: ENSMUSP00000138354
Gene: ENSMUSG00000004562

DomainStartEndE-ValueType
low complexity region 201 223 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 351 395 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein similar to guanosine nucleotide exchange factors for Rho GTPases. The encoded protein contains in its C-terminus a GEF domain involved in exchange activity and a pleckstrin homology domain. Alternatively spliced transcripts that encode different proteins have been described. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 A T 17: 46,306,003 Y1226* probably null Het
Ankle2 A G 5: 110,251,535 Y587C probably damaging Het
Ankrd52 T A 10: 128,387,610 M697K probably benign Het
Atp9a A G 2: 168,690,964 probably null Het
Ccdc169 T C 3: 55,140,124 V12A possibly damaging Het
Ces3b T A 8: 105,088,440 C284S probably damaging Het
Crocc TCTGAGCTGCTGAGCTGC TCTGAGCTGC 4: 141,041,807 probably null Het
Ecel1 A T 1: 87,151,483 M491K probably damaging Het
Gnaz C T 10: 75,014,871 R243W probably damaging Het
Homer1 C A 13: 93,402,095 R311S probably damaging Het
Myo5c A G 9: 75,284,198 D1118G probably benign Het
Olfr116 A G 17: 37,623,990 V215A probably benign Het
Olfr676 A C 7: 105,036,137 K313T probably benign Het
Pecam1 C T 11: 106,695,832 E185K possibly damaging Het
Rfx2 A T 17: 56,804,362 V70E possibly damaging Het
Sdk2 G A 11: 113,827,116 T1474M probably damaging Het
Slc39a12 G A 2: 14,449,826 A516T probably damaging Het
Tanc2 TGCAGCAGCAGCAGCAGCAGCAGC TGCAGCAGCAGCAGCAGCAGC 11: 105,921,855 probably benign Het
Timd2 T C 11: 46,677,237 I243M probably benign Het
Vmn2r108 A T 17: 20,472,283 S104T probably benign Het
Vmn2r56 T C 7: 12,712,965 N420S probably benign Het
Zfp148 T C 16: 33,496,143 I353T probably benign Het
Other mutations in Arhgef40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Arhgef40 APN 14 51988960 missense probably damaging 1.00
IGL00848:Arhgef40 APN 14 51987427 missense probably damaging 1.00
IGL00966:Arhgef40 APN 14 51991698 critical splice donor site probably null
IGL01123:Arhgef40 APN 14 51994346 missense probably damaging 0.99
IGL02110:Arhgef40 APN 14 51989405 missense probably damaging 1.00
IGL02490:Arhgef40 APN 14 51989195 missense probably damaging 0.99
IGL02505:Arhgef40 APN 14 52000863 missense probably damaging 1.00
IGL02636:Arhgef40 APN 14 51997408 missense probably damaging 1.00
R0200:Arhgef40 UTSW 14 51996974 missense probably damaging 0.99
R0496:Arhgef40 UTSW 14 52004907 unclassified probably benign
R0608:Arhgef40 UTSW 14 51996974 missense probably damaging 0.99
R0826:Arhgef40 UTSW 14 52000993 missense probably benign 0.05
R1126:Arhgef40 UTSW 14 51997126 missense probably damaging 0.96
R1330:Arhgef40 UTSW 14 51990156 missense probably benign 0.42
R1612:Arhgef40 UTSW 14 52004081 missense probably damaging 1.00
R1794:Arhgef40 UTSW 14 51989930 missense possibly damaging 0.94
R1844:Arhgef40 UTSW 14 51997623 missense probably damaging 0.99
R2018:Arhgef40 UTSW 14 52003705 missense probably damaging 1.00
R2064:Arhgef40 UTSW 14 51996183 missense probably damaging 1.00
R2321:Arhgef40 UTSW 14 51994276 splice site probably benign
R3877:Arhgef40 UTSW 14 52002285 missense probably damaging 1.00
R4233:Arhgef40 UTSW 14 51990171 missense possibly damaging 0.50
R4596:Arhgef40 UTSW 14 51987224 critical splice donor site probably null
R4676:Arhgef40 UTSW 14 51990959 nonsense probably null
R4703:Arhgef40 UTSW 14 52002310 missense probably damaging 1.00
R4704:Arhgef40 UTSW 14 52002310 missense probably damaging 1.00
R4719:Arhgef40 UTSW 14 52004938 unclassified probably benign
R4915:Arhgef40 UTSW 14 51990099 missense probably damaging 1.00
R4917:Arhgef40 UTSW 14 51990099 missense probably damaging 1.00
R4918:Arhgef40 UTSW 14 51990099 missense probably damaging 1.00
R5097:Arhgef40 UTSW 14 51989689 missense probably damaging 1.00
R5183:Arhgef40 UTSW 14 52004099 missense probably damaging 0.98
R5195:Arhgef40 UTSW 14 51989812 missense possibly damaging 0.68
R5367:Arhgef40 UTSW 14 51989699 missense probably damaging 0.99
R5381:Arhgef40 UTSW 14 51991849 missense probably damaging 0.99
R5594:Arhgef40 UTSW 14 51996157 missense probably damaging 1.00
R5632:Arhgef40 UTSW 14 51994338 missense probably damaging 1.00
R5665:Arhgef40 UTSW 14 52000900 missense possibly damaging 0.80
R5820:Arhgef40 UTSW 14 51987496 missense possibly damaging 0.76
R6229:Arhgef40 UTSW 14 51990090 missense probably benign 0.06
R6451:Arhgef40 UTSW 14 52000999 missense probably damaging 1.00
R6633:Arhgef40 UTSW 14 51997431 missense probably damaging 1.00
R6642:Arhgef40 UTSW 14 51990962 unclassified probably benign
R6675:Arhgef40 UTSW 14 51991641 missense probably damaging 0.99
R6781:Arhgef40 UTSW 14 51997897 intron probably benign
R6901:Arhgef40 UTSW 14 51997368 missense probably damaging 1.00
U24488:Arhgef40 UTSW 14 51998216 missense probably benign 0.07
X0023:Arhgef40 UTSW 14 52003684 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAACCTGTTCGGCTTTTGTAGG -3'
(R):5'- AGCTAGCTCAAGGCCTTCTTC -3'

Sequencing Primer
(F):5'- GCTTTTGTAGGCACACGAATG -3'
(R):5'- AATGTGATGGGGCTGCCC -3'
Posted On2016-12-15