Incidental Mutation 'R5798:Abcc10'
ID447326
Institutional Source Beutler Lab
Gene Symbol Abcc10
Ensembl Gene ENSMUSG00000032842
Gene NameATP-binding cassette, sub-family C (CFTR/MRP), member 10
SynonymsMrp7
MMRRC Submission 043210-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.121) question?
Stock #R5798 (G1)
Quality Score211
Status Not validated
Chromosome17
Chromosomal Location46303221-46328352 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 46306003 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 1226 (Y1226*)
Ref Sequence ENSEMBL: ENSMUSP00000131843 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047970] [ENSMUST00000061722] [ENSMUST00000095261] [ENSMUST00000166280] [ENSMUST00000166617] [ENSMUST00000167360] [ENSMUST00000170271] [ENSMUST00000171584] [ENSMUST00000188223]
Predicted Effect probably null
Transcript: ENSMUST00000047970
AA Change: Y1226*
SMART Domains Protein: ENSMUSP00000038041
Gene: ENSMUSG00000032842
AA Change: Y1226*

DomainStartEndE-ValueType
transmembrane domain 28 50 N/A INTRINSIC
transmembrane domain 70 89 N/A INTRINSIC
transmembrane domain 99 121 N/A INTRINSIC
transmembrane domain 134 153 N/A INTRINSIC
transmembrane domain 168 190 N/A INTRINSIC
Pfam:ABC_membrane 286 552 5.4e-24 PFAM
AAA 626 809 5.76e-8 SMART
low complexity region 841 852 N/A INTRINSIC
Pfam:ABC_membrane 889 1203 1.7e-33 PFAM
low complexity region 1231 1245 N/A INTRINSIC
AAA 1281 1490 3.57e-13 SMART
low complexity region 1506 1517 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000061722
SMART Domains Protein: ENSMUSP00000058470
Gene: ENSMUSG00000047428

DomainStartEndE-ValueType
EGF_like 71 101 3.16e1 SMART
EGF 102 132 7.76e-3 SMART
EGF 137 172 2.14e-5 SMART
EGF 177 215 3.79e-6 SMART
EGF_CA 217 253 3.1e-11 SMART
EGF_CA 255 291 9.47e-7 SMART
transmembrane domain 349 371 N/A INTRINSIC
low complexity region 383 394 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000095261
AA Change: Y1185*
SMART Domains Protein: ENSMUSP00000092895
Gene: ENSMUSG00000032842
AA Change: Y1185*

DomainStartEndE-ValueType
transmembrane domain 29 48 N/A INTRINSIC
transmembrane domain 58 80 N/A INTRINSIC
transmembrane domain 93 112 N/A INTRINSIC
transmembrane domain 127 149 N/A INTRINSIC
Pfam:ABC_membrane 245 511 2.1e-30 PFAM
AAA 585 768 5.76e-8 SMART
low complexity region 800 811 N/A INTRINSIC
transmembrane domain 836 858 N/A INTRINSIC
Pfam:ABC_membrane 896 1162 6.9e-26 PFAM
low complexity region 1190 1204 N/A INTRINSIC
AAA 1240 1424 1.67e-13 SMART
low complexity region 1440 1451 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166280
SMART Domains Protein: ENSMUSP00000126993
Gene: ENSMUSG00000047428

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
EGF_like 28 58 3.16e1 SMART
EGF 59 89 7.76e-3 SMART
EGF 94 129 2.14e-5 SMART
EGF 134 172 3.79e-6 SMART
EGF_CA 174 210 3.1e-11 SMART
EGF_CA 212 248 9.47e-7 SMART
transmembrane domain 306 328 N/A INTRINSIC
low complexity region 340 351 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166617
SMART Domains Protein: ENSMUSP00000128897
Gene: ENSMUSG00000047428

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
EGF_like 28 58 3.16e1 SMART
EGF 59 89 7.76e-3 SMART
EGF 94 129 2.14e-5 SMART
EGF 134 172 3.79e-6 SMART
EGF_CA 174 210 3.1e-11 SMART
EGF_CA 212 248 9.47e-7 SMART
transmembrane domain 306 328 N/A INTRINSIC
low complexity region 340 351 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000167360
AA Change: Y1226*
SMART Domains Protein: ENSMUSP00000131843
Gene: ENSMUSG00000032842
AA Change: Y1226*

DomainStartEndE-ValueType
transmembrane domain 28 50 N/A INTRINSIC
transmembrane domain 70 89 N/A INTRINSIC
transmembrane domain 99 121 N/A INTRINSIC
transmembrane domain 134 153 N/A INTRINSIC
transmembrane domain 168 190 N/A INTRINSIC
Pfam:ABC_membrane 286 552 2.2e-30 PFAM
AAA 626 809 5.76e-8 SMART
low complexity region 841 852 N/A INTRINSIC
transmembrane domain 877 899 N/A INTRINSIC
Pfam:ABC_membrane 937 1203 7.2e-26 PFAM
low complexity region 1231 1245 N/A INTRINSIC
AAA 1281 1465 1.67e-13 SMART
low complexity region 1481 1492 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170271
SMART Domains Protein: ENSMUSP00000132349
Gene: ENSMUSG00000047428

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
EGF_like 28 58 3.16e1 SMART
EGF 59 89 7.76e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171584
SMART Domains Protein: ENSMUSP00000132561
Gene: ENSMUSG00000032842

DomainStartEndE-ValueType
transmembrane domain 28 50 N/A INTRINSIC
transmembrane domain 70 89 N/A INTRINSIC
transmembrane domain 99 121 N/A INTRINSIC
transmembrane domain 134 153 N/A INTRINSIC
transmembrane domain 168 190 N/A INTRINSIC
Pfam:ABC_membrane 286 462 8.3e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188223
SMART Domains Protein: ENSMUSP00000141164
Gene: ENSMUSG00000047428

DomainStartEndE-ValueType
Pfam:hEGF 88 100 7.9e-4 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, and White). This ABC transporter is a member of the MRP subfamily which is involved in multi-drug resistance. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homzozygous for a knock-out allele exhibit increased sensitivity to paclitaxel-induced mortality associated with weight loss, decreased white blood cell, and small spleen and thymus cortex due to apoptosis and/or depopulation of lymphoid cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankle2 A G 5: 110,251,535 Y587C probably damaging Het
Ankrd52 T A 10: 128,387,610 M697K probably benign Het
Arhgef40 G T 14: 51,997,032 A931S probably damaging Het
Atp9a A G 2: 168,690,964 probably null Het
Ccdc169 T C 3: 55,140,124 V12A possibly damaging Het
Ces3b T A 8: 105,088,440 C284S probably damaging Het
Crocc TCTGAGCTGCTGAGCTGC TCTGAGCTGC 4: 141,041,807 probably null Het
Ecel1 A T 1: 87,151,483 M491K probably damaging Het
Gnaz C T 10: 75,014,871 R243W probably damaging Het
Homer1 C A 13: 93,402,095 R311S probably damaging Het
Myo5c A G 9: 75,284,198 D1118G probably benign Het
Olfr116 A G 17: 37,623,990 V215A probably benign Het
Olfr676 A C 7: 105,036,137 K313T probably benign Het
Pecam1 C T 11: 106,695,832 E185K possibly damaging Het
Rfx2 A T 17: 56,804,362 V70E possibly damaging Het
Sdk2 G A 11: 113,827,116 T1474M probably damaging Het
Slc39a12 G A 2: 14,449,826 A516T probably damaging Het
Tanc2 TGCAGCAGCAGCAGCAGCAGCAGC TGCAGCAGCAGCAGCAGCAGC 11: 105,921,855 probably benign Het
Timd2 T C 11: 46,677,237 I243M probably benign Het
Vmn2r108 A T 17: 20,472,283 S104T probably benign Het
Vmn2r56 T C 7: 12,712,965 N420S probably benign Het
Zfp148 T C 16: 33,496,143 I353T probably benign Het
Other mutations in Abcc10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00960:Abcc10 APN 17 46323745 missense probably damaging 1.00
IGL01115:Abcc10 APN 17 46310426 missense probably benign
IGL01380:Abcc10 APN 17 46324022 missense possibly damaging 0.90
IGL01476:Abcc10 APN 17 46327937 utr 5 prime probably benign
IGL01723:Abcc10 APN 17 46313745 missense probably damaging 1.00
IGL01867:Abcc10 APN 17 46324438 missense probably benign 0.07
IGL02065:Abcc10 APN 17 46312901 missense possibly damaging 0.60
IGL02233:Abcc10 APN 17 46324159 unclassified probably null
IGL03394:Abcc10 APN 17 46324351 missense probably damaging 1.00
decrepit UTSW 17 46324391 missense probably damaging 1.00
shrivelled UTSW 17 46312419 missense probably benign
PIT4514001:Abcc10 UTSW 17 46305648 missense probably benign
R0366:Abcc10 UTSW 17 46324798 nonsense probably null
R0437:Abcc10 UTSW 17 46312919 splice site probably null
R0437:Abcc10 UTSW 17 46312920 splice site probably benign
R0549:Abcc10 UTSW 17 46322290 missense probably damaging 1.00
R0580:Abcc10 UTSW 17 46305956 splice site probably null
R1056:Abcc10 UTSW 17 46303954 missense possibly damaging 0.60
R1426:Abcc10 UTSW 17 46324435 missense probably damaging 0.97
R1595:Abcc10 UTSW 17 46322238 missense probably damaging 1.00
R1745:Abcc10 UTSW 17 46312433 missense probably benign
R1856:Abcc10 UTSW 17 46306603 missense probably damaging 1.00
R1968:Abcc10 UTSW 17 46322199 missense probably damaging 1.00
R2070:Abcc10 UTSW 17 46303565 missense probably benign
R2071:Abcc10 UTSW 17 46303565 missense probably benign
R2255:Abcc10 UTSW 17 46305635 missense probably benign 0.18
R2425:Abcc10 UTSW 17 46310157 missense probably damaging 1.00
R4116:Abcc10 UTSW 17 46323891 missense possibly damaging 0.50
R4510:Abcc10 UTSW 17 46307210 missense probably damaging 0.98
R4511:Abcc10 UTSW 17 46307210 missense probably damaging 0.98
R4645:Abcc10 UTSW 17 46324774 missense probably damaging 1.00
R4689:Abcc10 UTSW 17 46324070 missense probably benign 0.00
R4778:Abcc10 UTSW 17 46304416 missense probably damaging 1.00
R5364:Abcc10 UTSW 17 46305651 missense probably benign 0.25
R5384:Abcc10 UTSW 17 46304435 missense possibly damaging 0.83
R5509:Abcc10 UTSW 17 46324259 missense probably benign 0.01
R5568:Abcc10 UTSW 17 46303908 splice site probably null
R5906:Abcc10 UTSW 17 46316559 missense probably benign 0.02
R5908:Abcc10 UTSW 17 46313804 missense probably damaging 1.00
R5942:Abcc10 UTSW 17 46312407 missense probably benign 0.02
R5968:Abcc10 UTSW 17 46310151 missense probably benign
R6038:Abcc10 UTSW 17 46304360 missense probably damaging 1.00
R6038:Abcc10 UTSW 17 46304360 missense probably damaging 1.00
R6109:Abcc10 UTSW 17 46310377 missense probably benign 0.00
R6623:Abcc10 UTSW 17 46323462 missense probably damaging 1.00
R6851:Abcc10 UTSW 17 46312419 missense probably benign
R6927:Abcc10 UTSW 17 46324391 missense probably damaging 1.00
R7176:Abcc10 UTSW 17 46324277 missense probably benign 0.02
R7314:Abcc10 UTSW 17 46315404 missense probably damaging 0.98
R7463:Abcc10 UTSW 17 46323772 missense probably damaging 1.00
X0020:Abcc10 UTSW 17 46324120 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AACAACAGGGCTGGACTGAC -3'
(R):5'- ACACTTCTCAGTACCCAGGGTC -3'

Sequencing Primer
(F):5'- CACAGTTAAGAATAGCAGCAGTC -3'
(R):5'- TCAGTACCCAGGGTCTCCTAG -3'
Posted On2016-12-15