Incidental Mutation 'R0545:4932438A13Rik'
ID44739
Institutional Source Beutler Lab
Gene Symbol 4932438A13Rik
Ensembl Gene ENSMUSG00000037270
Gene NameRIKEN cDNA 4932438A13 gene
SynonymsTweek, FSA
MMRRC Submission 038737-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.881) question?
Stock #R0545 (G1)
Quality Score208
Status Validated
Chromosome3
Chromosomal Location36863104-37053033 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to A at 36987690 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148720 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057272] [ENSMUST00000152564] [ENSMUST00000211820]
Predicted Effect probably benign
Transcript: ENSMUST00000057272
SMART Domains Protein: ENSMUSP00000060199
Gene: ENSMUSG00000037270

DomainStartEndE-ValueType
transmembrane domain 25 47 N/A INTRINSIC
low complexity region 701 716 N/A INTRINSIC
low complexity region 767 779 N/A INTRINSIC
low complexity region 1127 1138 N/A INTRINSIC
low complexity region 1154 1166 N/A INTRINSIC
low complexity region 1226 1240 N/A INTRINSIC
low complexity region 1381 1402 N/A INTRINSIC
low complexity region 1541 1547 N/A INTRINSIC
low complexity region 1593 1607 N/A INTRINSIC
low complexity region 1810 1821 N/A INTRINSIC
low complexity region 1981 1995 N/A INTRINSIC
low complexity region 2182 2191 N/A INTRINSIC
low complexity region 2336 2349 N/A INTRINSIC
low complexity region 2614 2657 N/A INTRINSIC
low complexity region 3468 3480 N/A INTRINSIC
low complexity region 3717 3742 N/A INTRINSIC
low complexity region 3816 3837 N/A INTRINSIC
low complexity region 3919 3929 N/A INTRINSIC
low complexity region 3941 3948 N/A INTRINSIC
low complexity region 4024 4038 N/A INTRINSIC
low complexity region 4041 4049 N/A INTRINSIC
low complexity region 4117 4149 N/A INTRINSIC
low complexity region 4172 4185 N/A INTRINSIC
low complexity region 4359 4380 N/A INTRINSIC
FSA_C 4386 4990 N/A SMART
low complexity region 4993 5004 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152564
SMART Domains Protein: ENSMUSP00000117808
Gene: ENSMUSG00000037270

DomainStartEndE-ValueType
transmembrane domain 25 47 N/A INTRINSIC
low complexity region 701 716 N/A INTRINSIC
low complexity region 767 779 N/A INTRINSIC
low complexity region 1127 1138 N/A INTRINSIC
low complexity region 1154 1166 N/A INTRINSIC
low complexity region 1226 1240 N/A INTRINSIC
low complexity region 1381 1402 N/A INTRINSIC
low complexity region 1541 1547 N/A INTRINSIC
low complexity region 1593 1607 N/A INTRINSIC
low complexity region 1810 1821 N/A INTRINSIC
low complexity region 1981 1995 N/A INTRINSIC
low complexity region 2182 2191 N/A INTRINSIC
low complexity region 2336 2349 N/A INTRINSIC
low complexity region 2614 2657 N/A INTRINSIC
low complexity region 3468 3480 N/A INTRINSIC
low complexity region 3717 3742 N/A INTRINSIC
low complexity region 3816 3837 N/A INTRINSIC
low complexity region 3919 3929 N/A INTRINSIC
low complexity region 3941 3948 N/A INTRINSIC
low complexity region 4024 4038 N/A INTRINSIC
low complexity region 4041 4049 N/A INTRINSIC
low complexity region 4117 4149 N/A INTRINSIC
low complexity region 4172 4185 N/A INTRINSIC
low complexity region 4359 4380 N/A INTRINSIC
FSA_C 4386 4990 N/A SMART
low complexity region 4993 5004 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000211820
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency 99% (66/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is located on the long arm of chromosome 4 in a region that is associated with susceptibility to celiac disease. The encoded protein is similar to a Chinese hamster protein that is associated with spermatocyte and adipocyte differentiation. The C-terminus of the protein is also similar to a Caenorhabditis elegans protein that plays a role in lipid storage. In mammals, this protein is thought to function in the regulation of epithelial growth and differentiation, and in tumor development. [provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik C T 2: 19,542,376 R76H probably damaging Het
Adnp2 T C 18: 80,129,401 I598V probably benign Het
Ago3 T C 4: 126,417,232 N63D probably damaging Het
Alkbh7 C T 17: 56,999,012 R138* probably null Het
Atp6ap1l T C 13: 90,883,663 H300R probably benign Het
BC051076 C T 5: 87,963,490 noncoding transcript Het
Bpifb9a T A 2: 154,261,950 C104* probably null Het
Cacna2d2 T C 9: 107,525,223 L826P probably damaging Het
Car5b G A X: 163,979,301 R282C probably damaging Het
Ccdc88c T C 12: 100,947,188 D526G probably damaging Het
Cdh23 T A 10: 60,331,291 T1861S probably benign Het
Ces2f A C 8: 104,950,036 M121L possibly damaging Het
Cfap58 G A 19: 47,941,097 probably benign Het
Chpf2 T C 5: 24,590,324 S282P possibly damaging Het
Cluap1 C T 16: 3,933,772 R332W probably damaging Het
Cma2 A T 14: 55,973,113 M86L probably benign Het
Cog6 A T 3: 52,996,075 M134K probably damaging Het
Col1a1 A G 11: 94,951,594 D1446G unknown Het
Cpne8 T A 15: 90,497,075 D512V probably damaging Het
Ctnna2 T A 6: 77,605,182 N352I probably damaging Het
Cyp2c69 A C 19: 39,886,661 L16R probably damaging Het
Dysf T C 6: 84,099,461 S603P probably damaging Het
Epha5 A G 5: 84,067,358 probably null Het
Ercc3 T C 18: 32,245,902 S270P probably damaging Het
F10 T A 8: 13,048,249 C151S probably damaging Het
Gpr180 T G 14: 118,160,046 H317Q possibly damaging Het
Gstp2 T C 19: 4,041,633 E32G possibly damaging Het
Ikzf5 T C 7: 131,392,500 T133A possibly damaging Het
Itch G T 2: 155,182,298 G274* probably null Het
Jarid2 T A 13: 44,902,831 N365K probably benign Het
Lama3 T A 18: 12,561,701 S1295T possibly damaging Het
Lipc A G 9: 70,812,705 L255P probably damaging Het
Lrrc38 A G 4: 143,350,758 D197G probably benign Het
Mfap2 A G 4: 141,014,185 probably benign Het
Mfhas1 A G 8: 35,589,048 K226E probably damaging Het
Morc1 A G 16: 48,565,657 R548G probably benign Het
Mrgprb5 T C 7: 48,168,885 N34S probably benign Het
Mroh4 T C 15: 74,625,427 T182A probably benign Het
Mylk G C 16: 34,879,475 E403Q possibly damaging Het
Myo5a T C 9: 75,167,037 F743L possibly damaging Het
Notch4 A C 17: 34,583,433 D1276A probably damaging Het
Olfr139 A G 11: 74,045,047 C76R possibly damaging Het
Olfr215 T A 6: 116,582,656 I97L probably benign Het
Olfr394 A T 11: 73,888,017 Y118* probably null Het
Olfr799 T A 10: 129,647,349 C74S probably damaging Het
Plin4 T A 17: 56,106,567 T353S probably damaging Het
Ppp1r9a A G 6: 5,115,357 T827A probably benign Het
Prlr C T 15: 10,317,566 T40I probably damaging Het
Psme3 T C 11: 101,319,904 probably benign Het
Pygb A T 2: 150,815,706 D363V probably benign Het
Rsph6a C T 7: 19,054,946 Q68* probably null Het
Serpini2 A G 3: 75,258,138 V178A probably benign Het
Sh2d2a T C 3: 87,851,888 probably benign Het
Skint7 A C 4: 111,980,198 M58L probably benign Het
Slco3a1 G T 7: 74,320,553 Y435* probably null Het
Stk17b T C 1: 53,762,583 probably benign Het
Tinag T A 9: 77,031,710 H162L possibly damaging Het
Ttc21a T A 9: 119,958,799 L811Q probably damaging Het
Ttc41 A T 10: 86,759,097 M912L probably benign Het
Vmn2r98 G T 17: 19,053,613 V41F probably benign Het
Washc5 C T 15: 59,342,093 C838Y possibly damaging Het
Wrnip1 A G 13: 32,806,813 T352A probably damaging Het
Zan A C 5: 137,396,177 C4467G unknown Het
Zc3h7a T C 16: 11,152,333 probably benign Het
Zfp729a C A 13: 67,620,226 C628F probably benign Het
Other mutations in 4932438A13Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:4932438A13Rik APN 3 37011727 missense probably benign 0.00
IGL00434:4932438A13Rik APN 3 36987299 missense probably damaging 0.98
IGL00640:4932438A13Rik APN 3 36908218 missense probably damaging 1.00
IGL00693:4932438A13Rik APN 3 37052547 utr 3 prime probably benign
IGL00721:4932438A13Rik APN 3 37030751 splice site probably null
IGL00756:4932438A13Rik APN 3 36908218 missense probably damaging 1.00
IGL00896:4932438A13Rik APN 3 37039462 missense probably benign
IGL00902:4932438A13Rik APN 3 37041345 missense probably damaging 1.00
IGL00980:4932438A13Rik APN 3 37000041 missense probably damaging 1.00
IGL01019:4932438A13Rik APN 3 37006984 critical splice acceptor site probably null
IGL01025:4932438A13Rik APN 3 37046280 missense possibly damaging 0.89
IGL01306:4932438A13Rik APN 3 37005013 splice site probably benign
IGL01370:4932438A13Rik APN 3 36947755 missense probably benign 0.07
IGL01377:4932438A13Rik APN 3 36973452 critical splice donor site probably null
IGL01401:4932438A13Rik APN 3 36942292 missense probably benign
IGL01419:4932438A13Rik APN 3 37048121 missense probably damaging 1.00
IGL01432:4932438A13Rik APN 3 37003759 missense possibly damaging 0.87
IGL01433:4932438A13Rik APN 3 36887770 missense probably damaging 1.00
IGL01452:4932438A13Rik APN 3 36996308 unclassified probably benign
IGL01520:4932438A13Rik APN 3 36973260 nonsense probably null
IGL01524:4932438A13Rik APN 3 36942382 missense possibly damaging 0.90
IGL01628:4932438A13Rik APN 3 37008485 missense probably damaging 1.00
IGL01638:4932438A13Rik APN 3 36974311 missense probably damaging 1.00
IGL01650:4932438A13Rik APN 3 36992673 splice site probably benign
IGL01717:4932438A13Rik APN 3 37034736 missense probably benign
IGL01767:4932438A13Rik APN 3 37041363 missense probably benign 0.29
IGL01813:4932438A13Rik APN 3 36928520 missense possibly damaging 0.90
IGL01998:4932438A13Rik APN 3 36957016 missense possibly damaging 0.49
IGL02172:4932438A13Rik APN 3 37004873 missense probably damaging 0.99
IGL02197:4932438A13Rik APN 3 36906735 missense probably damaging 1.00
IGL02248:4932438A13Rik APN 3 36969290 critical splice donor site probably null
IGL02273:4932438A13Rik APN 3 36921437 splice site probably benign
IGL02403:4932438A13Rik APN 3 37030664 missense probably benign
IGL02492:4932438A13Rik APN 3 37048113 missense probably benign 0.04
IGL02517:4932438A13Rik APN 3 36958868 missense probably damaging 1.00
IGL02519:4932438A13Rik APN 3 36895315 missense probably damaging 1.00
IGL02586:4932438A13Rik APN 3 37044608 nonsense probably null
IGL02620:4932438A13Rik APN 3 37035945 missense possibly damaging 0.95
IGL02621:4932438A13Rik APN 3 37041484 splice site probably benign
IGL02670:4932438A13Rik APN 3 36967305 nonsense probably null
IGL02806:4932438A13Rik APN 3 36946494 missense possibly damaging 0.95
IGL02985:4932438A13Rik APN 3 36958757 missense probably damaging 0.99
IGL03004:4932438A13Rik APN 3 36965677 splice site probably benign
IGL03037:4932438A13Rik APN 3 36969207 missense probably benign 0.23
IGL03037:4932438A13Rik APN 3 36969208 missense probably damaging 1.00
IGL03062:4932438A13Rik APN 3 37038517 splice site probably benign
IGL03137:4932438A13Rik APN 3 37034602 missense probably damaging 0.98
IGL03150:4932438A13Rik APN 3 36948066 missense probably damaging 1.00
IGL03204:4932438A13Rik APN 3 37050934 splice site probably benign
IGL03207:4932438A13Rik APN 3 36949996 missense possibly damaging 0.73
IGL03256:4932438A13Rik APN 3 36906683 splice site probably benign
IGL03264:4932438A13Rik APN 3 37002635 missense probably damaging 1.00
IGL03265:4932438A13Rik APN 3 37047991 missense probably benign 0.00
IGL03303:4932438A13Rik APN 3 36870077 missense possibly damaging 0.90
FR4340:4932438A13Rik UTSW 3 37050752 critical splice acceptor site probably benign
FR4737:4932438A13Rik UTSW 3 37050754 critical splice acceptor site probably benign
R0035:4932438A13Rik UTSW 3 36987598 nonsense probably null
R0047:4932438A13Rik UTSW 3 36908192 missense possibly damaging 0.83
R0047:4932438A13Rik UTSW 3 36908192 missense possibly damaging 0.83
R0068:4932438A13Rik UTSW 3 36952221 missense probably benign 0.28
R0068:4932438A13Rik UTSW 3 36952221 missense probably benign 0.28
R0092:4932438A13Rik UTSW 3 37028159 missense probably benign 0.41
R0233:4932438A13Rik UTSW 3 36948563 nonsense probably null
R0233:4932438A13Rik UTSW 3 36948563 nonsense probably null
R0256:4932438A13Rik UTSW 3 36917773 missense probably benign 0.01
R0277:4932438A13Rik UTSW 3 36943182 nonsense probably null
R0321:4932438A13Rik UTSW 3 36906788 splice site probably null
R0323:4932438A13Rik UTSW 3 36943182 nonsense probably null
R0335:4932438A13Rik UTSW 3 36969152 missense probably damaging 1.00
R0375:4932438A13Rik UTSW 3 37046252 missense probably damaging 0.99
R0437:4932438A13Rik UTSW 3 36989804 missense possibly damaging 0.81
R0445:4932438A13Rik UTSW 3 37000065 missense probably damaging 0.99
R0496:4932438A13Rik UTSW 3 36987635 missense probably damaging 1.00
R0531:4932438A13Rik UTSW 3 37036825 missense probably damaging 1.00
R0543:4932438A13Rik UTSW 3 36996458 missense probably benign 0.22
R0674:4932438A13Rik UTSW 3 37044626 missense possibly damaging 0.86
R0745:4932438A13Rik UTSW 3 36928463 missense probably damaging 1.00
R0755:4932438A13Rik UTSW 3 36946364 missense probably damaging 1.00
R0785:4932438A13Rik UTSW 3 36959334 splice site probably benign
R1056:4932438A13Rik UTSW 3 36983453 missense possibly damaging 0.69
R1056:4932438A13Rik UTSW 3 37044680 missense probably benign 0.44
R1080:4932438A13Rik UTSW 3 36988255 missense probably damaging 1.00
R1103:4932438A13Rik UTSW 3 36996523 missense probably benign
R1119:4932438A13Rik UTSW 3 36987045 missense probably damaging 1.00
R1170:4932438A13Rik UTSW 3 37044631 missense probably damaging 0.98
R1183:4932438A13Rik UTSW 3 36895303 missense possibly damaging 0.51
R1186:4932438A13Rik UTSW 3 36996312 unclassified probably benign
R1201:4932438A13Rik UTSW 3 36948375 missense probably benign
R1219:4932438A13Rik UTSW 3 36946470 nonsense probably null
R1270:4932438A13Rik UTSW 3 36952184 missense probably damaging 1.00
R1273:4932438A13Rik UTSW 3 36987210 missense probably damaging 1.00
R1338:4932438A13Rik UTSW 3 37052535 missense unknown
R1364:4932438A13Rik UTSW 3 36987030 missense probably damaging 1.00
R1437:4932438A13Rik UTSW 3 36942429 missense possibly damaging 0.65
R1447:4932438A13Rik UTSW 3 36965586 missense probably damaging 0.98
R1467:4932438A13Rik UTSW 3 37035945 missense probably damaging 0.99
R1467:4932438A13Rik UTSW 3 37035945 missense probably damaging 0.99
R1470:4932438A13Rik UTSW 3 36998331 missense probably benign 0.31
R1470:4932438A13Rik UTSW 3 36998331 missense probably benign 0.31
R1481:4932438A13Rik UTSW 3 37008434 missense probably damaging 0.99
R1528:4932438A13Rik UTSW 3 37052535 missense unknown
R1533:4932438A13Rik UTSW 3 37041375 missense probably damaging 1.00
R1546:4932438A13Rik UTSW 3 36870056 missense possibly damaging 0.64
R1606:4932438A13Rik UTSW 3 36942399 missense probably damaging 1.00
R1638:4932438A13Rik UTSW 3 37035812 nonsense probably null
R1772:4932438A13Rik UTSW 3 36959432 missense probably damaging 1.00
R1896:4932438A13Rik UTSW 3 36908231 nonsense probably null
R1919:4932438A13Rik UTSW 3 37006983 critical splice acceptor site probably null
R1983:4932438A13Rik UTSW 3 36887865 missense probably null 1.00
R1987:4932438A13Rik UTSW 3 36953985 critical splice donor site probably null
R1992:4932438A13Rik UTSW 3 37000032 missense probably benign 0.32
R1999:4932438A13Rik UTSW 3 36908211 missense probably damaging 1.00
R2004:4932438A13Rik UTSW 3 36895378 missense possibly damaging 0.77
R2010:4932438A13Rik UTSW 3 36928551 missense probably benign 0.09
R2027:4932438A13Rik UTSW 3 37047961 splice site probably benign
R2039:4932438A13Rik UTSW 3 37003878 missense possibly damaging 0.66
R2054:4932438A13Rik UTSW 3 36947853 missense probably benign 0.01
R2089:4932438A13Rik UTSW 3 36988256 missense probably damaging 1.00
R2091:4932438A13Rik UTSW 3 36988256 missense probably damaging 1.00
R2091:4932438A13Rik UTSW 3 36953970 missense probably damaging 1.00
R2091:4932438A13Rik UTSW 3 36988256 missense probably damaging 1.00
R2220:4932438A13Rik UTSW 3 36875530 critical splice donor site probably null
R2374:4932438A13Rik UTSW 3 36885396 missense probably benign 0.00
R2437:4932438A13Rik UTSW 3 36958685 splice site probably null
R2860:4932438A13Rik UTSW 3 36965849 missense probably damaging 1.00
R2861:4932438A13Rik UTSW 3 36965849 missense probably damaging 1.00
R2909:4932438A13Rik UTSW 3 36947953 missense probably damaging 1.00
R2925:4932438A13Rik UTSW 3 37007122 missense probably damaging 0.99
R2940:4932438A13Rik UTSW 3 36958805 missense probably damaging 1.00
R3015:4932438A13Rik UTSW 3 36875462 missense probably damaging 1.00
R3086:4932438A13Rik UTSW 3 37011703 missense possibly damaging 0.56
R3159:4932438A13Rik UTSW 3 36959415 missense probably benign 0.17
R3440:4932438A13Rik UTSW 3 37041912 nonsense probably null
R3703:4932438A13Rik UTSW 3 36987581 missense probably damaging 1.00
R3705:4932438A13Rik UTSW 3 36987581 missense probably damaging 1.00
R3795:4932438A13Rik UTSW 3 37030565 missense probably benign 0.30
R3820:4932438A13Rik UTSW 3 37040434 missense probably damaging 1.00
R3862:4932438A13Rik UTSW 3 36885398 missense possibly damaging 0.73
R3944:4932438A13Rik UTSW 3 37030061 missense possibly damaging 0.90
R4020:4932438A13Rik UTSW 3 37012575 intron probably benign
R4091:4932438A13Rik UTSW 3 37030589 missense probably benign 0.00
R4159:4932438A13Rik UTSW 3 36931083 missense probably benign 0.00
R4231:4932438A13Rik UTSW 3 36920236 missense probably benign 0.10
R4368:4932438A13Rik UTSW 3 36988147 nonsense probably null
R4413:4932438A13Rik UTSW 3 36958681 splice site probably null
R4475:4932438A13Rik UTSW 3 37040395 missense probably damaging 1.00
R4488:4932438A13Rik UTSW 3 37003933 missense probably null 0.93
R4489:4932438A13Rik UTSW 3 37003933 missense probably null 0.93
R4516:4932438A13Rik UTSW 3 36895311 missense possibly damaging 0.90
R4580:4932438A13Rik UTSW 3 37030025 missense probably benign 0.02
R4672:4932438A13Rik UTSW 3 36889990 makesense probably null
R4705:4932438A13Rik UTSW 3 37041889 missense probably benign 0.03
R4735:4932438A13Rik UTSW 3 37004967 missense possibly damaging 0.84
R4741:4932438A13Rik UTSW 3 36942375 missense probably damaging 0.99
R4754:4932438A13Rik UTSW 3 37022466 nonsense probably null
R4778:4932438A13Rik UTSW 3 36937065 missense possibly damaging 0.90
R4833:4932438A13Rik UTSW 3 36964968 missense probably damaging 0.96
R4896:4932438A13Rik UTSW 3 36965937 missense probably damaging 1.00
R4910:4932438A13Rik UTSW 3 36998199 missense probably damaging 1.00
R4922:4932438A13Rik UTSW 3 36987165 missense probably damaging 1.00
R4941:4932438A13Rik UTSW 3 36917702 missense probably damaging 1.00
R4941:4932438A13Rik UTSW 3 36919901 missense probably benign 0.41
R4980:4932438A13Rik UTSW 3 36943312 missense probably damaging 1.00
R5030:4932438A13Rik UTSW 3 36943399 intron probably benign
R5049:4932438A13Rik UTSW 3 37040506 intron probably benign
R5049:4932438A13Rik UTSW 3 37041390 missense probably damaging 1.00
R5089:4932438A13Rik UTSW 3 36987502 missense probably benign 0.02
R5092:4932438A13Rik UTSW 3 37000085 missense probably benign 0.14
R5122:4932438A13Rik UTSW 3 37034757 splice site probably null
R5210:4932438A13Rik UTSW 3 37033265 missense possibly damaging 0.85
R5246:4932438A13Rik UTSW 3 37048050 missense probably damaging 1.00
R5289:4932438A13Rik UTSW 3 37000109 missense probably damaging 0.97
R5348:4932438A13Rik UTSW 3 37048146 missense probably damaging 1.00
R5394:4932438A13Rik UTSW 3 36917668 missense probably damaging 1.00
R5434:4932438A13Rik UTSW 3 36875516 missense probably damaging 1.00
R5667:4932438A13Rik UTSW 3 36917677 missense probably benign 0.00
R5686:4932438A13Rik UTSW 3 36917660 missense probably benign 0.00
R5701:4932438A13Rik UTSW 3 36921360 missense probably benign 0.10
R5778:4932438A13Rik UTSW 3 36958714 missense probably damaging 1.00
R5787:4932438A13Rik UTSW 3 36992733 unclassified probably null
R5800:4932438A13Rik UTSW 3 37052443 missense probably damaging 1.00
R5819:4932438A13Rik UTSW 3 37048600 missense probably benign 0.12
R5820:4932438A13Rik UTSW 3 37039526 missense probably benign 0.00
R5952:4932438A13Rik UTSW 3 36965621 missense probably damaging 1.00
R5975:4932438A13Rik UTSW 3 36969221 missense possibly damaging 0.64
R5996:4932438A13Rik UTSW 3 36931116 missense probably benign 0.07
R6192:4932438A13Rik UTSW 3 36988169 missense probably benign 0.00
R6225:4932438A13Rik UTSW 3 36948304 missense probably damaging 1.00
R6234:4932438A13Rik UTSW 3 36983471 missense probably benign 0.00
R6244:4932438A13Rik UTSW 3 36956999 missense probably benign
R6263:4932438A13Rik UTSW 3 36931111 missense probably benign 0.06
R6351:4932438A13Rik UTSW 3 36908228 missense probably damaging 1.00
R6380:4932438A13Rik UTSW 3 37033307 missense probably benign 0.19
R6468:4932438A13Rik UTSW 3 37008443 missense probably damaging 1.00
R6759:4932438A13Rik UTSW 3 36988085 missense possibly damaging 0.81
R6792:4932438A13Rik UTSW 3 37011566 critical splice acceptor site probably null
R6809:4932438A13Rik UTSW 3 36874282 missense probably damaging 0.98
R6841:4932438A13Rik UTSW 3 37021481 missense probably damaging 1.00
R6959:4932438A13Rik UTSW 3 36967189 missense probably damaging 1.00
X0050:4932438A13Rik UTSW 3 36957128 missense probably damaging 1.00
Z1088:4932438A13Rik UTSW 3 36987567 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTTCGAGAGGGAGTCTCAATGGTG -3'
(R):5'- AGCAGTCTATGTCAGGGTCAAGGAG -3'

Sequencing Primer
(F):5'- AGTCTCAATGGTGGCAACAG -3'
(R):5'- TCAGGGTCAAGGAGGAAGTATG -3'
Posted On2013-06-11