Incidental Mutation 'R0545:Cog6'
ID44740
Institutional Source Beutler Lab
Gene Symbol Cog6
Ensembl Gene ENSMUSG00000027742
Gene Namecomponent of oligomeric golgi complex 6
Synonyms
MMRRC Submission 038737-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0545 (G1)
Quality Score210
Status Validated
Chromosome3
Chromosomal Location52981875-53017237 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 52996075 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 134 (M134K)
Ref Sequence ENSEMBL: ENSMUSP00000141733 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036665] [ENSMUST00000193432] [ENSMUST00000195183]
Predicted Effect probably damaging
Transcript: ENSMUST00000036665
AA Change: M406K

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000048603
Gene: ENSMUSG00000027742
AA Change: M406K

DomainStartEndE-ValueType
low complexity region 13 26 N/A INTRINSIC
COG6 55 656 N/A SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192788
Predicted Effect probably damaging
Transcript: ENSMUST00000193432
AA Change: M406K

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000141339
Gene: ENSMUSG00000027742
AA Change: M406K

DomainStartEndE-ValueType
low complexity region 13 26 N/A INTRINSIC
COG6 55 625 5e-289 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194779
Predicted Effect probably damaging
Transcript: ENSMUST00000195183
AA Change: M134K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141733
Gene: ENSMUSG00000027742
AA Change: M134K

DomainStartEndE-ValueType
low complexity region 13 26 N/A INTRINSIC
Pfam:COG6 39 174 5.5e-32 PFAM
Meta Mutation Damage Score 0.396 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency 99% (66/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the conserved oligomeric Golgi complex that is required for maintaining normal structure and activity of the Golgi apparatus. The encoded protein is organized with conserved oligomeric Golgi complex components 5, 7 and 8 into a sub-complex referred to as lobe B. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Feb 2009]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik C T 2: 19,542,376 R76H probably damaging Het
4932438A13Rik G A 3: 36,987,690 probably benign Het
Adnp2 T C 18: 80,129,401 I598V probably benign Het
Ago3 T C 4: 126,417,232 N63D probably damaging Het
Alkbh7 C T 17: 56,999,012 R138* probably null Het
Atp6ap1l T C 13: 90,883,663 H300R probably benign Het
BC051076 C T 5: 87,963,490 noncoding transcript Het
Bpifb9a T A 2: 154,261,950 C104* probably null Het
Cacna2d2 T C 9: 107,525,223 L826P probably damaging Het
Car5b G A X: 163,979,301 R282C probably damaging Het
Ccdc88c T C 12: 100,947,188 D526G probably damaging Het
Cdh23 T A 10: 60,331,291 T1861S probably benign Het
Ces2f A C 8: 104,950,036 M121L possibly damaging Het
Cfap58 G A 19: 47,941,097 probably benign Het
Chpf2 T C 5: 24,590,324 S282P possibly damaging Het
Cluap1 C T 16: 3,933,772 R332W probably damaging Het
Cma2 A T 14: 55,973,113 M86L probably benign Het
Col1a1 A G 11: 94,951,594 D1446G unknown Het
Cpne8 T A 15: 90,497,075 D512V probably damaging Het
Ctnna2 T A 6: 77,605,182 N352I probably damaging Het
Cyp2c69 A C 19: 39,886,661 L16R probably damaging Het
Dysf T C 6: 84,099,461 S603P probably damaging Het
Epha5 A G 5: 84,067,358 probably null Het
Ercc3 T C 18: 32,245,902 S270P probably damaging Het
F10 T A 8: 13,048,249 C151S probably damaging Het
Gpr180 T G 14: 118,160,046 H317Q possibly damaging Het
Gstp2 T C 19: 4,041,633 E32G possibly damaging Het
Ikzf5 T C 7: 131,392,500 T133A possibly damaging Het
Itch G T 2: 155,182,298 G274* probably null Het
Jarid2 T A 13: 44,902,831 N365K probably benign Het
Lama3 T A 18: 12,561,701 S1295T possibly damaging Het
Lipc A G 9: 70,812,705 L255P probably damaging Het
Lrrc38 A G 4: 143,350,758 D197G probably benign Het
Mfap2 A G 4: 141,014,185 probably benign Het
Mfhas1 A G 8: 35,589,048 K226E probably damaging Het
Morc1 A G 16: 48,565,657 R548G probably benign Het
Mrgprb5 T C 7: 48,168,885 N34S probably benign Het
Mroh4 T C 15: 74,625,427 T182A probably benign Het
Mylk G C 16: 34,879,475 E403Q possibly damaging Het
Myo5a T C 9: 75,167,037 F743L possibly damaging Het
Notch4 A C 17: 34,583,433 D1276A probably damaging Het
Olfr139 A G 11: 74,045,047 C76R possibly damaging Het
Olfr215 T A 6: 116,582,656 I97L probably benign Het
Olfr394 A T 11: 73,888,017 Y118* probably null Het
Olfr799 T A 10: 129,647,349 C74S probably damaging Het
Plin4 T A 17: 56,106,567 T353S probably damaging Het
Ppp1r9a A G 6: 5,115,357 T827A probably benign Het
Prlr C T 15: 10,317,566 T40I probably damaging Het
Psme3 T C 11: 101,319,904 probably benign Het
Pygb A T 2: 150,815,706 D363V probably benign Het
Rsph6a C T 7: 19,054,946 Q68* probably null Het
Serpini2 A G 3: 75,258,138 V178A probably benign Het
Sh2d2a T C 3: 87,851,888 probably benign Het
Skint7 A C 4: 111,980,198 M58L probably benign Het
Slco3a1 G T 7: 74,320,553 Y435* probably null Het
Stk17b T C 1: 53,762,583 probably benign Het
Tinag T A 9: 77,031,710 H162L possibly damaging Het
Ttc21a T A 9: 119,958,799 L811Q probably damaging Het
Ttc41 A T 10: 86,759,097 M912L probably benign Het
Vmn2r98 G T 17: 19,053,613 V41F probably benign Het
Washc5 C T 15: 59,342,093 C838Y possibly damaging Het
Wrnip1 A G 13: 32,806,813 T352A probably damaging Het
Zan A C 5: 137,396,177 C4467G unknown Het
Zc3h7a T C 16: 11,152,333 probably benign Het
Zfp729a C A 13: 67,620,226 C628F probably benign Het
Other mutations in Cog6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01922:Cog6 APN 3 52986425 missense probably benign 0.03
IGL01946:Cog6 APN 3 53002404 intron probably benign
IGL02122:Cog6 APN 3 52998342 missense probably benign 0.04
IGL02589:Cog6 APN 3 53007270 missense probably damaging 1.00
IGL02819:Cog6 APN 3 53009545 missense probably damaging 0.98
R0045:Cog6 UTSW 3 52992750 unclassified probably null
R0045:Cog6 UTSW 3 52992750 unclassified probably null
R0086:Cog6 UTSW 3 52993570 missense probably damaging 0.98
R0707:Cog6 UTSW 3 53013862 missense possibly damaging 0.71
R0718:Cog6 UTSW 3 53010629 missense probably benign 0.35
R1169:Cog6 UTSW 3 53013844 missense probably benign 0.30
R1451:Cog6 UTSW 3 53009113 missense possibly damaging 0.78
R1891:Cog6 UTSW 3 52983180 missense probably benign
R2249:Cog6 UTSW 3 53000479 critical splice donor site probably null
R2264:Cog6 UTSW 3 52992911 nonsense probably null
R3745:Cog6 UTSW 3 52992819 missense probably benign 0.05
R4027:Cog6 UTSW 3 53002529 missense possibly damaging 0.95
R4230:Cog6 UTSW 3 52992808 missense probably benign 0.13
R4400:Cog6 UTSW 3 53012941 missense probably benign 0.11
R4551:Cog6 UTSW 3 52998320 missense probably damaging 1.00
R4866:Cog6 UTSW 3 53010598 missense probably benign 0.10
R5326:Cog6 UTSW 3 53013816 missense probably null 0.12
R6169:Cog6 UTSW 3 53007301 missense probably benign 0.03
R6273:Cog6 UTSW 3 52996052 missense probably damaging 1.00
R7169:Cog6 UTSW 3 52989966 missense possibly damaging 0.94
R7199:Cog6 UTSW 3 52983189 missense probably benign 0.21
R7243:Cog6 UTSW 3 53002315 missense probably damaging 1.00
R7299:Cog6 UTSW 3 53002507 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGCTTCACTGTGTCACATCAGCTC -3'
(R):5'- GTGCATCTCCAGCCTCAGATTTAGG -3'

Sequencing Primer
(F):5'- GATTAACTCTGACCTGGGAGCTAC -3'
(R):5'- AGGAGATGAACTTCGTTGGC -3'
Posted On2013-06-11