Incidental Mutation 'R5799:Olfr818'
ID447410
Institutional Source Beutler Lab
Gene Symbol Olfr818
Ensembl Gene ENSMUSG00000058071
Gene Nameolfactory receptor 818
SynonymsGA_x6K02T2PULF-11624146-11623190, MOR110-2
MMRRC Submission 043388-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.039) question?
Stock #R5799 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location129944396-129949100 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 129945911 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 50 (D50E)
Ref Sequence ENSEMBL: ENSMUSP00000149259 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074308] [ENSMUST00000205227] [ENSMUST00000215527]
Predicted Effect possibly damaging
Transcript: ENSMUST00000074308
AA Change: D50E

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000073918
Gene: ENSMUSG00000058071
AA Change: D50E

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 1.4e-47 PFAM
Pfam:7tm_1 39 287 3.5e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205227
SMART Domains Protein: ENSMUSP00000145108
Gene: ENSMUSG00000058071

DomainStartEndE-ValueType
Pfam:7tm_1 1 122 5e-13 PFAM
Pfam:7tm_4 1 123 8.7e-24 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000215527
AA Change: D50E

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
Meta Mutation Damage Score 0.106 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 89% (51/57)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933416C03Rik T C 10: 116,112,769 E284G probably damaging Het
AA986860 C T 1: 130,741,171 Q92* probably null Het
Accsl T C 2: 93,864,403 probably null Het
Ahnak2 T C 12: 112,778,930 probably benign Het
Alcam T C 16: 52,309,849 D46G probably benign Het
Asap2 T C 12: 21,168,246 S57P probably damaging Het
Atg14 A T 14: 47,547,295 V314D possibly damaging Het
C230029F24Rik C T 1: 49,338,148 noncoding transcript Het
Calcr A T 6: 3,707,592 I236N probably benign Het
Cass4 G A 2: 172,416,187 G35E probably damaging Het
Chmp6 T C 11: 119,916,691 I120T probably benign Het
Col13a1 A G 10: 61,849,140 probably benign Het
Ddhd2 T A 8: 25,748,602 L328F probably damaging Het
Dnmt3l A G 10: 78,052,026 D123G possibly damaging Het
Eea1 T A 10: 96,002,948 V287E possibly damaging Het
Efcc1 A G 6: 87,731,182 N97S probably benign Het
Exd1 A G 2: 119,538,781 S118P probably benign Het
Ext2 G T 2: 93,811,972 T184K probably benign Het
Fam186a G A 15: 99,966,824 Q42* probably null Het
Gbp2 A T 3: 142,632,082 I320L probably benign Het
Gm15292 T A 8: 21,250,343 probably null Het
Gm5483 T A 16: 36,184,261 M1K probably null Het
Gramd2 G A 9: 59,708,016 G13R probably benign Het
H2-Q5 T C 17: 35,394,139 M5T unknown Het
Jak3 C T 8: 71,678,700 L70F probably damaging Het
Lhpp G A 7: 132,705,635 V254M probably damaging Het
Lig1 T A 7: 13,296,258 V387E possibly damaging Het
Lipo1 T C 19: 33,777,693 probably benign Het
Lrrc8b C T 5: 105,481,342 S518L probably benign Het
Narf T C 11: 121,244,654 Y111H probably damaging Het
Ncf4 A G 15: 78,250,977 K78R probably benign Het
Nrap A T 19: 56,342,169 C1118* probably null Het
Nubp2 A G 17: 24,885,798 V23A probably damaging Het
Olfr723 A T 14: 49,929,040 F168Y probably damaging Het
Olfr972 T C 9: 39,874,096 S274P possibly damaging Het
Pdzd7 G A 19: 45,036,989 P356S probably benign Het
Rttn T C 18: 89,037,946 V984A probably damaging Het
Ryr3 A G 2: 112,686,580 S3334P probably damaging Het
Senp7 G A 16: 56,139,105 probably null Het
Slc25a3 A C 10: 91,122,041 Y50D probably benign Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Slc38a2 A T 15: 96,695,089 S163T probably benign Het
Sp110 A C 1: 85,577,329 F434C probably benign Het
Stam2 A T 2: 52,720,910 C4* probably null Het
Taf1a A G 1: 183,395,934 D50G possibly damaging Het
Taf6l A T 19: 8,782,631 Y106N possibly damaging Het
Tbx20 G A 9: 24,725,520 Q424* probably null Het
Tex10 A G 4: 48,433,295 V829A possibly damaging Het
Tgfbr3 T C 5: 107,109,608 probably benign Het
Tnfsf10 G T 3: 27,335,593 V268F probably damaging Het
Trrap A G 5: 144,830,945 T2571A probably benign Het
Other mutations in Olfr818
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00897:Olfr818 APN 10 129945911 missense possibly damaging 0.95
IGL00951:Olfr818 APN 10 129945712 missense probably damaging 0.99
IGL01700:Olfr818 APN 10 129945941 missense probably damaging 1.00
IGL02313:Olfr818 APN 10 129945903 missense probably damaging 1.00
IGL02373:Olfr818 APN 10 129945465 missense probably benign 0.11
IGL02983:Olfr818 APN 10 129945189 missense probably damaging 1.00
R0730:Olfr818 UTSW 10 129945111 missense probably benign 0.04
R1574:Olfr818 UTSW 10 129945510 missense probably damaging 1.00
R1574:Olfr818 UTSW 10 129945510 missense probably damaging 1.00
R1789:Olfr818 UTSW 10 129945582 nonsense probably null
R1824:Olfr818 UTSW 10 129945337 missense possibly damaging 0.67
R2107:Olfr818 UTSW 10 129945712 missense probably damaging 0.99
R2398:Olfr818 UTSW 10 129945207 missense probably benign 0.04
R6048:Olfr818 UTSW 10 129945826 missense possibly damaging 0.67
R7027:Olfr818 UTSW 10 129945172 missense possibly damaging 0.60
Predicted Primers PCR Primer
(F):5'- AGAACTCTGTGGCCCCTAGTAG -3'
(R):5'- GGCATGTTCAAAGAGTGACTTG -3'

Sequencing Primer
(F):5'- CTGGGAATGCAGACTGTA -3'
(R):5'- TGTTCAAAGAGTGACTTGAATGTTG -3'
Posted On2016-12-15