Incidental Mutation 'R5813:Mark3'
ID447644
Institutional Source Beutler Lab
Gene Symbol Mark3
Ensembl Gene ENSMUSG00000007411
Gene NameMAP/microtubule affinity regulating kinase 3
SynonymsA430080F22Rik, ETK-1, C-TAK1, 1600015G02Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.212) question?
Stock #R5813 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location111574523-111656221 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 111655443 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 673 (L673P)
Ref Sequence ENSEMBL: ENSMUSP00000074757 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075281] [ENSMUST00000084953] [ENSMUST00000221459] [ENSMUST00000221753]
Predicted Effect probably damaging
Transcript: ENSMUST00000075281
AA Change: L673P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000074757
Gene: ENSMUSG00000007411
AA Change: L673P

DomainStartEndE-ValueType
S_TKc 56 307 7.4e-109 SMART
UBA 328 365 6.91e-9 SMART
low complexity region 368 385 N/A INTRINSIC
low complexity region 406 419 N/A INTRINSIC
Pfam:KA1 683 729 3.7e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000084953
AA Change: L688P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000082017
Gene: ENSMUSG00000007411
AA Change: L688P

DomainStartEndE-ValueType
S_TKc 56 307 7.4e-109 SMART
UBA 328 365 6.91e-9 SMART
low complexity region 368 385 N/A INTRINSIC
low complexity region 406 419 N/A INTRINSIC
Pfam:KA1 700 744 4e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000221459
AA Change: L697P

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000221753
AA Change: L741P

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221841
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222080
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is activated by phosphorylation and in turn is involved in the phosphorylation of tau proteins MAP2 and MAP4. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous disruption of this gene results in decreased body weight, increased energy expenditure, reduced adiposity, and protection from high-fat diet induced obesity. On a high-fat diet, mice show resistance to hepatic steatosis, improved glucose tolerance, and decreased insulin levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam15 A G 3: 89,345,828 Y230H probably benign Het
Ano7 G T 1: 93,384,919 probably null Het
Arap2 T C 5: 62,677,163 Y792C probably damaging Het
Art3 C A 5: 92,412,241 probably benign Het
Atad2 C T 15: 58,099,854 G1085D probably benign Het
Birc6 C A 17: 74,646,502 A3253E probably damaging Het
C530008M17Rik A G 5: 76,858,428 T879A unknown Het
C9 C T 15: 6,497,126 P547L probably benign Het
Cecr2 T C 6: 120,762,208 S1271P probably damaging Het
Ces1e T A 8: 93,221,677 K105* probably null Het
Cpsf4 A G 5: 145,178,873 N204S probably benign Het
Dgkz T C 2: 91,939,388 D615G possibly damaging Het
Disp1 G T 1: 183,088,410 N815K probably damaging Het
Enah A G 1: 181,931,185 probably benign Het
Fcgbp A G 7: 28,101,494 T1322A possibly damaging Het
Frem1 A G 4: 83,000,158 F516L probably damaging Het
Fry G A 5: 150,399,671 A1096T probably damaging Het
Fyco1 T C 9: 123,831,348 Y190C probably damaging Het
Gfra1 T C 19: 58,239,255 D417G probably benign Het
Gigyf2 T C 1: 87,440,763 I1055T probably damaging Het
Invs A G 4: 48,398,146 E444G probably damaging Het
Itga10 A G 3: 96,652,585 T519A probably benign Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Kdm2b A G 5: 122,871,868 S727P probably benign Het
Kidins220 A T 12: 25,057,140 K1531* probably null Het
Ksr1 C T 11: 79,038,198 V266M probably damaging Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Lipi T C 16: 75,573,910 R140G possibly damaging Het
Lrrc32 T C 7: 98,498,411 S133P probably damaging Het
Map3k7 T A 4: 31,964,318 I19N probably damaging Het
Marf1 A G 16: 14,152,585 V90A probably benign Het
Meis1 T C 11: 19,016,229 H48R probably benign Het
Mettl26 G A 17: 25,876,021 V87M probably damaging Het
Mknk2 T C 10: 80,675,862 R5G probably benign Het
Mterf1b T C 5: 4,196,956 V199A possibly damaging Het
Ncs1 T A 2: 31,280,654 probably null Het
Nek10 T C 14: 14,986,704 V1014A probably benign Het
Notch2 A G 3: 98,135,428 N1370D probably benign Het
Nr2e3 TCCATCGGAGTGTTCCC TC 9: 59,943,418 probably benign Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1032 T C 2: 86,008,292 I172T probably damaging Het
Olfr922 T A 9: 38,815,656 M51K probably benign Het
Olfr952 A G 9: 39,426,736 C112R probably damaging Het
Opn5 C G 17: 42,593,006 R146T probably damaging Het
Pcdhb18 G A 18: 37,490,484 R289Q probably benign Het
Pcyox1l C T 18: 61,699,288 probably null Het
Plxnb2 T C 15: 89,160,759 T1128A possibly damaging Het
Prex1 T C 2: 166,583,207 T960A probably benign Het
Prkaa2 A C 4: 105,036,094 *553G probably null Het
Rasgrp4 A G 7: 29,145,214 D297G probably damaging Het
Sdf4 G A 4: 155,999,399 V109I probably benign Het
Serpinb3d T C 1: 107,079,297 K227R probably benign Het
Sgsm1 A T 5: 113,250,956 I750N probably damaging Het
Shtn1 T A 19: 59,032,241 K183M probably damaging Het
Slc22a30 T C 19: 8,404,581 T109A probably benign Het
Slco1c1 A G 6: 141,542,203 D99G probably damaging Het
Soga3 G T 10: 29,150,244 V441F probably damaging Het
Tcf25 T A 8: 123,395,615 probably null Het
Tex10 A G 4: 48,452,928 V677A probably benign Het
Tmem131l A G 3: 83,940,572 S329P probably benign Het
Trappc10 T A 10: 78,222,739 N136I probably damaging Het
Trpt1 T C 19: 6,998,538 F173L probably benign Het
Ttc37 A G 13: 76,155,733 T1257A probably benign Het
Ube4b G A 4: 149,337,468 R955C probably damaging Het
Usp34 C A 11: 23,421,340 P1840T probably benign Het
Vmn1r27 A T 6: 58,216,000 N6K possibly damaging Het
Wdr25 T C 12: 109,027,421 V521A possibly damaging Het
Wdr64 G A 1: 175,812,057 E1031K possibly damaging Het
Wnt10a A G 1: 74,800,596 N147S probably damaging Het
Zbed5 T C 5: 129,902,218 I336T possibly damaging Het
Zfp758 T A 17: 22,375,815 H427Q probably damaging Het
Zfp961 C A 8: 71,968,226 H194Q probably damaging Het
Other mutations in Mark3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01609:Mark3 APN 12 111627522 missense probably damaging 0.99
IGL02047:Mark3 APN 12 111618363 missense probably damaging 1.00
IGL02345:Mark3 APN 12 111627107 missense probably damaging 0.99
IGL02637:Mark3 APN 12 111592656 missense probably damaging 0.98
IGL03310:Mark3 APN 12 111647670 missense probably benign
IGL03349:Mark3 APN 12 111628250 missense probably benign 0.19
R0377:Mark3 UTSW 12 111629029 missense probably damaging 0.96
R0551:Mark3 UTSW 12 111633634 missense probably benign
R0846:Mark3 UTSW 12 111627224 missense possibly damaging 0.85
R1104:Mark3 UTSW 12 111618397 splice site probably benign
R1305:Mark3 UTSW 12 111615446 critical splice donor site probably null
R1344:Mark3 UTSW 12 111627837 missense possibly damaging 0.94
R1418:Mark3 UTSW 12 111627837 missense possibly damaging 0.94
R1434:Mark3 UTSW 12 111623325 splice site probably benign
R1556:Mark3 UTSW 12 111627841 missense probably damaging 0.98
R1569:Mark3 UTSW 12 111633746 missense probably benign 0.01
R1582:Mark3 UTSW 12 111655310 missense probably benign 0.12
R1936:Mark3 UTSW 12 111618365 missense probably damaging 0.99
R1975:Mark3 UTSW 12 111615441 missense probably damaging 1.00
R2507:Mark3 UTSW 12 111627242 missense probably damaging 1.00
R4394:Mark3 UTSW 12 111604523 missense possibly damaging 0.91
R4912:Mark3 UTSW 12 111592653 missense probably benign 0.42
R4926:Mark3 UTSW 12 111618324 nonsense probably null
R5060:Mark3 UTSW 12 111618326 missense probably damaging 0.98
R5133:Mark3 UTSW 12 111655328 missense probably damaging 1.00
R5834:Mark3 UTSW 12 111624487 missense probably damaging 0.99
R5926:Mark3 UTSW 12 111592734 missense probably damaging 1.00
R6523:Mark3 UTSW 12 111627235 missense probably damaging 1.00
R6663:Mark3 UTSW 12 111575083 missense probably benign 0.42
R6719:Mark3 UTSW 12 111615442 missense probably damaging 1.00
R6942:Mark3 UTSW 12 111592654 missense probably null 0.02
R6966:Mark3 UTSW 12 111640024 missense probably damaging 0.96
R6978:Mark3 UTSW 12 111627148 missense probably benign
R7303:Mark3 UTSW 12 111655536 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGTCGCAATGTGTCTTCAG -3'
(R):5'- GCTCTGGAAAACACCTTAAATTGC -3'

Sequencing Primer
(F):5'- CGCAATGTGTCTTCAGAGCAG -3'
(R):5'- AACCGGACTCCATTCAGA -3'
Posted On2016-12-15