Incidental Mutation 'R5813:0610011F06Rik'
List |< first << previous [record 49 of 386652] next >> last >|
ID447652
Institutional Source Beutler Lab
Gene Symbol 0610011F06Rik
Ensembl Gene ENSMUSG00000025731
Gene NameRIKEN cDNA 0610011F06 gene
Synonyms
Accession Numbers
Stock #R5813 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location25875464-25886007 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 25876021 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 87 (V87M)
Ref Sequence ENSEMBL: ENSMUSP00000130209 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026827] [ENSMUST00000163356] [ENSMUST00000169308]
Predicted Effect probably damaging
Transcript: ENSMUST00000026827
AA Change: V87M

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000026827
Gene: ENSMUSG00000025731
AA Change: V87M

DomainStartEndE-ValueType
Pfam:DUF938 1 203 7.4e-95 PFAM
Pfam:Methyltransf_25 31 133 1.1e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000163356
AA Change: V87M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000130209
Gene: ENSMUSG00000025731
AA Change: V87M

DomainStartEndE-ValueType
Pfam:DUF938 1 172 1.6e-74 PFAM
Pfam:Methyltransf_25 31 133 9e-8 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000169308
AA Change: V87M

PolyPhen 2 Score 0.924 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000126198
Gene: ENSMUSG00000025731
AA Change: V87M

DomainStartEndE-ValueType
Pfam:DUF938 1 194 5.6e-86 PFAM
Pfam:Methyltransf_25 31 133 4.4e-8 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600029O15Rik C T 9: 58,208,333 T445I noncoding transcript Het
Adam15 A G 3: 89,345,828 Y230H probably benign Het
Adarb1 T C 10: 77,321,805 *396W noncoding transcript Het
Ano7 G T 1: 93,384,919 probably null Het
Arap2 T C 5: 62,677,163 Y792C probably damaging Het
Art3 C A 5: 92,412,241 T356N unknown Het
Birc6 C A 17: 74,646,502 A3253E probably damaging Het
C530008M17Rik A G 5: 76,858,428 T879A unknown Het
C9 C T 15: 6,497,126 P547L probably benign Het
Cecr2 T C 6: 120,762,208 S1271P probably damaging Het
Ces1e T A 8: 93,221,677 K106* probably null Het
Cpsf4 A G 5: 145,178,873 N229S probably benign Het
D930015E06Rik A G 3: 83,940,572 S329P probably benign Het
Dgkz T C 2: 91,939,388 D615G possibly damaging Het
Disp1 G T 1: 183,088,410 N815K probably damaging Het
Fcgbp A G 7: 28,101,494 T1322A possibly damaging Het
Frem1 A G 4: 83,000,158 F516L probably damaging Het
Fry G A 5: 150,399,671 A1096T probably damaging Het
Fyco1 T C 9: 123,831,348 Y190C probably damaging Het
Gigyf2 T C 1: 87,440,763 I1055T probably damaging Het
Gm21846 T C 5: 22,775,747 F40L noncoding transcript Het
Invs A G 4: 48,398,146 E444G probably damaging Het
Itga10 A G 3: 96,652,585 T519A probably benign Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Kdm2b A G 5: 122,871,868 S1222P probably benign Het
Kidins220 A T 12: 25,057,140 K1561* probably null Het
Ksr1 C T 11: 79,038,198 V348M probably damaging Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Lipi T C 16: 75,573,910 R140G possibly damaging Het
Lrrc32 T C 7: 98,498,411 S133P probably damaging Het
Map3k7 T A 4: 31,964,318 I19N probably damaging Het
Marf1 A G 16: 14,152,585 V90A probably benign Het
Mark3 T C 12: 111,655,443 L673P not run Het
Meis1 T C 11: 19,016,229 H48R probably benign Het
Mknk2 T C 10: 80,675,862 R5G probably benign Het
Mterf1b T C 5: 4,196,956 V199A possibly damaging Het
Ncs1 T A 2: 31,280,654 probably null Het
Nek10 T C 14: 14,986,704 V1014A probably benign Het
Notch2 A G 3: 98,135,428 N1370D probably benign Het
Nr2e3 TCCATCGGAGTGTTCCC TC 9: 59,943,418 unknown Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1032 T C 2: 86,008,292 I172T probably damaging Het
Olfr922 T A 9: 38,815,656 M51K probably benign Het
Olfr952 A G 9: 39,426,736 C112R probably damaging Het
Opn5 C G 17: 42,593,006 R146T probably damaging Het
Pcdhb18 G A 18: 37,490,484 R289Q probably benign Het
Pcyox1l C T 18: 61,699,288 probably null Het
Plxnb2 T C 15: 89,160,759 T1128A possibly damaging Het
Prex1 T C 2: 166,583,207 T1130A probably benign Het
Prkaa2 A C 4: 105,036,094 *553G probably null Het
Rasgrp4 A G 7: 29,145,214 D308G probably damaging Het
Rpl27-ps1 A G 1: 171,305,211 V95A noncoding transcript Het
Sec31a A G 5: 100,365,902 L121P noncoding transcript Het
Serpinb3d T C 1: 107,079,297 K227R probably benign Het
Sgsm1 A T 5: 113,250,956 I1037N probably damaging Het
Shtn1 T A 19: 59,032,241 K183M probably damaging Het
Slc22a30 T C 19: 8,404,581 T109A probably benign Het
Slco1c1 A G 6: 141,542,203 D217G probably damaging Het
Srsf11 C T 3: 158,023,344 R109Q noncoding transcript Het
Tcf25 T A 8: 123,395,615 L429Q probably damaging Het
Tex10 A G 4: 48,452,928 V677A probably benign Het
Trappc10 T A 10: 78,222,739 N136I probably damaging Het
Trpt1 T C 19: 6,998,538 F173L probably benign Het
Ttc37 A G 13: 76,155,733 T1257A probably benign Het
Ube4b G A 4: 149,337,468 R955C probably damaging Het
Usp34 C A 11: 23,421,340 P1840T probably benign Het
Vmn1r27 A T 6: 58,216,000 N6K possibly damaging Het
Wdr12 T A 1: 60,097,570 E43V noncoding transcript Het
Wdr25 T C 12: 109,027,421 V521A possibly damaging Het
Wdr64 G A 1: 175,812,057 E1031K possibly damaging Het
Wnt10a A G 1: 74,800,596 N147S probably damaging Het
Zbed5 T C 5: 129,902,218 I336T possibly damaging Het
Zfp758 T A 17: 22,375,815 H427Q probably damaging Het
Zfp961 C A 8: 71,968,226 H194Q probably damaging Het
Other mutations in 0610011F06Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:0610011F06Rik APN 17 25876124 critical splice donor site probably null 0.00
R4985:0610011F06Rik UTSW 17 25876776 makesense probably null
Predicted Primers PCR Primer
(F):5'- TAGGGTCGACAAAGATACCCG -3'
(R):5'- CAGCCTTGGTTTTGAGCAG -3'

Sequencing Primer
(F):5'- AAGATACCCGCTTGCTGC -3'
(R):5'- CAGGTGTCCTGCTGCTCTAAAGAG -3'
Posted OnDec 15, 2016