Incidental Mutation 'R5814:Or1e16'
ID 447699
Institutional Source Beutler Lab
Gene Symbol Or1e16
Ensembl Gene ENSMUSG00000069823
Gene Name olfactory receptor family 1 subfamily E member 16
Synonyms GA_x6K02T2P1NL-3556334-3555390, MOR135-13, I54, Olfr1
MMRRC Submission 043396-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.196) question?
Stock # R5814 (G1)
Quality Score 217
Status Validated
Chromosome 11
Chromosomal Location 73285902-73290321 bp(-) (GRCm39)
Type of Mutation frame shift
DNA Base Change (assembly) AGCGGTCGTAGGC to AGC at 73286480 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000120899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120303] [ENSMUST00000131253] [ENSMUST00000134011]
AlphaFold Q8VGI1
Predicted Effect probably null
Transcript: ENSMUST00000120303
SMART Domains Protein: ENSMUSP00000113707
Gene: ENSMUSG00000069823

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 8.7e-60 PFAM
Pfam:7tm_1 41 290 2e-27 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000131253
SMART Domains Protein: ENSMUSP00000120899
Gene: ENSMUSG00000069823

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 31 184 1.2e-6 PFAM
Pfam:7TM_GPCR_Srsx 35 171 6.1e-8 PFAM
Pfam:7tm_1 41 191 3.6e-30 PFAM
Pfam:7tm_4 139 196 1.4e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134011
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency 91% (52/57)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933402N03Rik T C 7: 130,740,811 (GRCm39) D135G probably benign Het
Arrdc3 G T 13: 81,038,698 (GRCm39) R220L possibly damaging Het
Bace1 A G 9: 45,771,562 (GRCm39) D458G probably damaging Het
Cacna1s A G 1: 136,034,880 (GRCm39) Y1360C probably benign Het
Ccnb1-ps T C 7: 41,756,522 (GRCm39) noncoding transcript Het
Cd209b T C 8: 3,973,348 (GRCm39) E112G probably damaging Het
Cit T A 5: 116,117,478 (GRCm39) L1176Q probably damaging Het
Clcn3 T C 8: 61,387,607 (GRCm39) Y214C probably damaging Het
Clvs2 G T 10: 33,404,503 (GRCm39) Q238K probably benign Het
Creb3l3 C T 10: 80,921,496 (GRCm39) V350M probably benign Het
Crot A C 5: 9,023,996 (GRCm39) D373E probably damaging Het
Cyp4a12b T A 4: 115,289,694 (GRCm39) I187N probably damaging Het
Degs1l G A 1: 180,882,663 (GRCm39) V142I probably damaging Het
Dnhd1 C A 7: 105,369,102 (GRCm39) A4291D possibly damaging Het
Dnmt3b A T 2: 153,514,417 (GRCm39) E403D probably benign Het
Ect2l A T 10: 18,075,757 (GRCm39) I43K probably damaging Het
Efcab3 T A 11: 104,626,940 (GRCm39) probably benign Het
Ep400 C A 5: 110,843,444 (GRCm39) probably null Het
Erp27 A T 6: 136,888,564 (GRCm39) V138E possibly damaging Het
Gbp4 G A 5: 105,267,785 (GRCm39) A487V probably benign Het
Gm10142 C A 10: 77,551,957 (GRCm39) T106N probably damaging Het
Gxylt2 C A 6: 100,710,196 (GRCm39) H112Q probably damaging Het
Hexim2 G A 11: 103,029,209 (GRCm39) R87Q probably damaging Het
Hgf A G 5: 16,807,305 (GRCm39) N399S probably benign Het
Ikbke T A 1: 131,199,516 (GRCm39) I302F probably damaging Het
Itgb4 C T 11: 115,874,983 (GRCm39) R447W probably benign Het
Kdm1b A G 13: 47,216,622 (GRCm39) probably null Het
Krtap19-9a T C 16: 88,721,002 (GRCm39) noncoding transcript Het
Lin9 T A 1: 180,496,763 (GRCm39) L351I probably benign Het
Mmp10 G A 9: 7,503,621 (GRCm39) A164T possibly damaging Het
Myrip G A 9: 120,253,734 (GRCm39) G269D probably benign Het
Paxbp1 G T 16: 90,827,384 (GRCm39) R420S probably damaging Het
Pcbp2 T A 15: 102,391,597 (GRCm39) S38R probably damaging Het
Pcf11 A G 7: 92,306,922 (GRCm39) V1082A probably benign Het
Pkhd1 T C 1: 20,269,629 (GRCm39) E3305G probably damaging Het
Pla2g4c T A 7: 13,074,543 (GRCm39) W250R probably damaging Het
Prune2 A G 19: 16,993,725 (GRCm39) probably null Het
Rpsa A G 9: 119,957,551 (GRCm39) probably benign Het
Sema3e A G 5: 14,275,680 (GRCm39) I262V probably benign Het
Setd2 T A 9: 110,396,826 (GRCm39) L1663* probably null Het
Sh3d19 G A 3: 86,033,911 (GRCm39) V755I probably benign Het
Spag9 T A 11: 93,973,654 (GRCm39) V14E possibly damaging Het
Srsf11 C T 3: 157,728,981 (GRCm39) probably benign Het
Sspo A T 6: 48,428,818 (GRCm39) Q411L probably damaging Het
Sycp1 A C 3: 102,803,213 (GRCm39) S532R probably benign Het
Taf6l C A 19: 8,752,210 (GRCm39) A493S probably benign Het
Tsnaxip1 A G 8: 106,570,603 (GRCm39) D574G probably benign Het
Ttll10 T A 4: 156,132,084 (GRCm39) K117N possibly damaging Het
Uqcc5 A G 14: 30,846,477 (GRCm39) probably null Het
Utp4 T A 8: 107,638,907 (GRCm39) I405K probably damaging Het
Vmn2r45 T A 7: 8,474,475 (GRCm39) Y851F probably benign Het
Vps33a T C 5: 123,703,119 (GRCm39) D168G probably damaging Het
Other mutations in Or1e16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01380:Or1e16 APN 11 73,286,017 (GRCm39) missense probably damaging 0.98
IGL01938:Or1e16 APN 11 73,286,471 (GRCm39) missense probably damaging 1.00
IGL02270:Or1e16 APN 11 73,286,191 (GRCm39) missense probably benign
IGL03287:Or1e16 APN 11 73,286,845 (GRCm39) start codon destroyed probably null 1.00
R0006:Or1e16 UTSW 11 73,286,314 (GRCm39) missense probably damaging 0.99
R0907:Or1e16 UTSW 11 73,285,945 (GRCm39) missense probably damaging 0.97
R1982:Or1e16 UTSW 11 73,285,918 (GRCm39) missense probably benign 0.00
R3804:Or1e16 UTSW 11 73,286,776 (GRCm39) missense probably benign 0.01
R4064:Or1e16 UTSW 11 73,286,348 (GRCm39) missense probably benign 0.04
R4171:Or1e16 UTSW 11 73,286,365 (GRCm39) missense probably damaging 1.00
R4724:Or1e16 UTSW 11 73,285,981 (GRCm39) missense probably damaging 1.00
R4732:Or1e16 UTSW 11 73,286,521 (GRCm39) missense probably benign 0.03
R4733:Or1e16 UTSW 11 73,286,521 (GRCm39) missense probably benign 0.03
R5030:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5097:Or1e16 UTSW 11 73,286,119 (GRCm39) missense probably damaging 1.00
R5098:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5101:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5135:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5137:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5192:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5193:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5193:Or1e16 UTSW 11 73,286,479 (GRCm39) frame shift probably null
R5197:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5220:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5221:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5222:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5258:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5297:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5396:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5398:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5399:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5432:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5433:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5531:Or1e16 UTSW 11 73,286,003 (GRCm39) missense probably benign 0.26
R5634:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5714:Or1e16 UTSW 11 73,286,187 (GRCm39) splice site probably null
R5812:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5813:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5815:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5913:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5955:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5956:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5968:Or1e16 UTSW 11 73,286,018 (GRCm39) missense possibly damaging 0.75
R6029:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R6034:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R6034:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R6176:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R6177:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R6178:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R6196:Or1e16 UTSW 11 73,286,299 (GRCm39) missense probably benign 0.08
R6995:Or1e16 UTSW 11 73,286,410 (GRCm39) missense probably benign
R7035:Or1e16 UTSW 11 73,286,544 (GRCm39) missense probably benign 0.00
R7470:Or1e16 UTSW 11 73,286,714 (GRCm39) missense probably damaging 1.00
R7530:Or1e16 UTSW 11 73,279,189 (GRCm39) missense possibly damaging 0.55
R8461:Or1e16 UTSW 11 73,285,982 (GRCm39) missense probably damaging 1.00
R9149:Or1e16 UTSW 11 73,286,853 (GRCm39) unclassified probably benign
R9279:Or1e16 UTSW 11 73,279,789 (GRCm39) missense probably benign 0.05
R9293:Or1e16 UTSW 11 73,285,955 (GRCm39) missense probably damaging 0.99
R9682:Or1e16 UTSW 11 73,286,025 (GRCm39) missense probably benign 0.03
R9752:Or1e16 UTSW 11 73,286,479 (GRCm39) missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- CATTAACACGGGTGTCAGAGC -3'
(R):5'- TCCACACACCCATGTACTTG -3'

Sequencing Primer
(F):5'- TGTCAGAGCAGGCCAGCTTTAG -3'
(R):5'- ATGTACTTGTTTCTCAGCAACTTG -3'
Posted On 2016-12-15