Incidental Mutation 'R5781:Arhgap10'
ID447732
Institutional Source Beutler Lab
Gene Symbol Arhgap10
Ensembl Gene ENSMUSG00000037148
Gene NameRho GTPase activating protein 10
SynonymsPSGAP-m, A930033B01Rik, PSGAP-s
MMRRC Submission 043378-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.198) question?
Stock #R5781 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location77250366-77517953 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 77450707 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 100 (Q100K)
Ref Sequence ENSEMBL: ENSMUSP00000147485 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076316] [ENSMUST00000210519] [ENSMUST00000210922]
Predicted Effect possibly damaging
Transcript: ENSMUST00000076316
AA Change: Q100K

PolyPhen 2 Score 0.555 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000075658
Gene: ENSMUSG00000037148
AA Change: Q100K

DomainStartEndE-ValueType
Pfam:BAR_3 6 249 3.3e-91 PFAM
PH 266 374 1.93e-6 SMART
RhoGAP 393 571 1.66e-63 SMART
low complexity region 633 649 N/A INTRINSIC
SH3 731 786 1.91e-13 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000210519
AA Change: Q100K

PolyPhen 2 Score 0.555 (Sensitivity: 0.88; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000210922
AA Change: Q100K

PolyPhen 2 Score 0.555 (Sensitivity: 0.88; Specificity: 0.91)
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit paraparesis, ataxic hindlimbs and splaying of hindlimbs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 A G 11: 110,101,987 L1617P probably damaging Het
Abhd16b T C 2: 181,494,154 V283A probably damaging Het
Adamts19 G T 18: 58,837,968 R208L possibly damaging Het
Adamts4 T C 1: 171,251,015 I56T possibly damaging Het
Alpk1 A C 3: 127,680,035 V773G possibly damaging Het
Arhgef18 T A 8: 3,439,439 probably null Het
Asb15 A T 6: 24,564,378 H277L probably benign Het
Ascc3 T A 10: 50,637,978 V291E probably damaging Het
Cnot6l A C 5: 96,086,165 V329G probably benign Het
Col14a1 A G 15: 55,423,512 T910A unknown Het
Dhdds G A 4: 133,996,830 L58F probably damaging Het
Dsc2 A G 18: 20,032,510 I846T probably benign Het
Evc A T 5: 37,326,570 S129T probably damaging Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Fyco1 A G 9: 123,794,833 V1377A probably damaging Het
Haus6 C T 4: 86,601,263 A203T possibly damaging Het
Hkdc1 T G 10: 62,417,933 D23A probably damaging Het
Hpdl C T 4: 116,820,578 V229M probably damaging Het
Hspa12a T C 19: 58,822,086 Y175C probably damaging Het
Hyal1 C T 9: 107,577,667 P59S probably damaging Het
Itpr1 G A 6: 108,510,738 C2374Y probably benign Het
Kmt2a A T 9: 44,847,842 Y114* probably null Het
Mc2r A T 18: 68,407,395 Y276N possibly damaging Het
Mc2r A T 18: 68,407,397 I275K probably damaging Het
Mlycd A G 8: 119,410,280 Y413C probably damaging Het
Mocs2 T G 13: 114,820,919 S86R probably damaging Het
Msx2 C A 13: 53,472,608 A35S probably benign Het
Olfr770 A T 10: 129,133,147 L207H probably damaging Het
Pla2g4f C A 2: 120,305,023 S390I probably damaging Het
Plcl1 C T 1: 55,695,989 A163V possibly damaging Het
Pnn T C 12: 59,071,819 V396A probably damaging Het
Rbmxl1 G A 8: 78,505,641 probably benign Het
Recql G T 6: 142,365,618 probably null Het
Rev3l T A 10: 39,823,093 N1195K probably benign Het
Rfwd3 G A 8: 111,273,084 T754M probably benign Het
Sctr A G 1: 120,031,620 T98A probably damaging Het
Sdk1 T A 5: 141,936,048 D6E probably benign Het
Smpdl3a T A 10: 57,807,938 I264K possibly damaging Het
Spag6 A G 2: 18,731,993 I154V probably benign Het
Tbc1d12 A C 19: 38,882,683 T297P probably benign Het
Tgfb1 A G 7: 25,696,960 D226G probably benign Het
Ubr3 G T 2: 70,016,244 probably null Het
Ubr4 T C 4: 139,468,096 Y1210H probably damaging Het
Ubr5 T C 15: 38,006,541 T1157A probably benign Het
Vmn2r120 T G 17: 57,524,938 T284P probably benign Het
Vps13b G T 15: 35,794,035 A2286S probably damaging Het
Zcchc14 A T 8: 121,604,593 probably benign Het
Zfr2 T A 10: 81,243,713 V362E probably benign Het
Other mutations in Arhgap10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01529:Arhgap10 APN 8 77346291 missense possibly damaging 0.80
IGL01689:Arhgap10 APN 8 77411134 splice site probably benign
IGL01802:Arhgap10 APN 8 77420085 missense probably damaging 0.99
IGL01832:Arhgap10 APN 8 77259129 missense probably benign 0.00
IGL02291:Arhgap10 APN 8 77382715 splice site probably benign
IGL02834:Arhgap10 APN 8 77365100 missense probably damaging 1.00
IGL02928:Arhgap10 APN 8 77250910 unclassified probably benign
IGL03149:Arhgap10 APN 8 77409538 splice site probably benign
IGL03215:Arhgap10 APN 8 77277152 missense probably benign
IGL03331:Arhgap10 APN 8 77420082 missense probably damaging 0.99
R0276:Arhgap10 UTSW 8 77413581 missense probably benign 0.11
R0376:Arhgap10 UTSW 8 77450824 splice site probably benign
R0454:Arhgap10 UTSW 8 77250965 missense probably damaging 0.97
R0714:Arhgap10 UTSW 8 77351687 splice site probably benign
R1033:Arhgap10 UTSW 8 77257347 missense possibly damaging 0.80
R1036:Arhgap10 UTSW 8 77310769 missense probably damaging 0.98
R1083:Arhgap10 UTSW 8 77517749 missense probably damaging 1.00
R1596:Arhgap10 UTSW 8 77450697 missense possibly damaging 0.93
R1710:Arhgap10 UTSW 8 77358587 nonsense probably null
R1918:Arhgap10 UTSW 8 77259079 missense probably benign
R1937:Arhgap10 UTSW 8 77344653 missense probably damaging 1.00
R1959:Arhgap10 UTSW 8 77409626 missense possibly damaging 0.78
R2348:Arhgap10 UTSW 8 77450926 splice site probably benign
R3703:Arhgap10 UTSW 8 77259056 critical splice donor site probably null
R3979:Arhgap10 UTSW 8 77420725 missense probably benign 0.01
R4854:Arhgap10 UTSW 8 77420089 nonsense probably null
R4855:Arhgap10 UTSW 8 77432738 critical splice donor site probably null
R4928:Arhgap10 UTSW 8 77426328 critical splice donor site probably null
R5033:Arhgap10 UTSW 8 77382757 missense probably damaging 0.99
R5532:Arhgap10 UTSW 8 77420072 missense probably benign 0.19
R5644:Arhgap10 UTSW 8 77411055 missense probably benign 0.00
R5824:Arhgap10 UTSW 8 77358552 nonsense probably null
R5861:Arhgap10 UTSW 8 77310764 missense probably damaging 1.00
R5872:Arhgap10 UTSW 8 77344638 critical splice donor site probably null
R6360:Arhgap10 UTSW 8 77259202 nonsense probably null
R6423:Arhgap10 UTSW 8 77517757 missense probably damaging 1.00
R6694:Arhgap10 UTSW 8 77411063 missense probably benign 0.00
R6900:Arhgap10 UTSW 8 77310862 missense probably damaging 1.00
R6936:Arhgap10 UTSW 8 77310747 nonsense probably null
R7001:Arhgap10 UTSW 8 77365088 missense possibly damaging 0.51
R7150:Arhgap10 UTSW 8 77250954 missense not run
Predicted Primers PCR Primer
(F):5'- CAGAAACTTCAGCAGAGAGGTC -3'
(R):5'- TCGCTCAGAGACTTCAAGTTCG -3'

Sequencing Primer
(F):5'- GTCCAGGACCTTGACCAAG -3'
(R):5'- CAGAGACTTCAAGTTCGAGTTTATC -3'
Posted On2016-12-15