Incidental Mutation 'R5781:Rfwd3'
ID447734
Institutional Source Beutler Lab
Gene Symbol Rfwd3
Ensembl Gene ENSMUSG00000033596
Gene Namering finger and WD repeat domain 3
Synonyms
MMRRC Submission 043378-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.614) question?
Stock #R5781 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location111270944-111300222 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 111273084 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 754 (T754M)
Ref Sequence ENSEMBL: ENSMUSP00000043780 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038739]
Predicted Effect probably benign
Transcript: ENSMUST00000038739
AA Change: T754M

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000043780
Gene: ENSMUSG00000033596
AA Change: T754M

DomainStartEndE-ValueType
low complexity region 222 243 N/A INTRINSIC
RING 288 331 3.78e-5 SMART
coiled coil region 355 403 N/A INTRINSIC
WD40 486 526 1.38e-2 SMART
WD40 529 568 6.43e-3 SMART
Blast:WD40 683 730 2e-12 BLAST
Blast:WD40 733 772 4e-15 BLAST
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit female and male fertility (possibly infertility), gonad atrophy, oligospermia, failure of follicular development, increased cellular sensitivity to MMC treatment, and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 A G 11: 110,101,987 L1617P probably damaging Het
Abhd16b T C 2: 181,494,154 V283A probably damaging Het
Adamts19 G T 18: 58,837,968 R208L possibly damaging Het
Adamts4 T C 1: 171,251,015 I56T possibly damaging Het
Alpk1 A C 3: 127,680,035 V773G possibly damaging Het
Arhgap10 G T 8: 77,450,707 Q100K possibly damaging Het
Arhgef18 T A 8: 3,439,439 probably null Het
Asb15 A T 6: 24,564,378 H277L probably benign Het
Ascc3 T A 10: 50,637,978 V291E probably damaging Het
Cnot6l A C 5: 96,086,165 V329G probably benign Het
Col14a1 A G 15: 55,423,512 T910A unknown Het
Dhdds G A 4: 133,996,830 L58F probably damaging Het
Dsc2 A G 18: 20,032,510 I846T probably benign Het
Evc A T 5: 37,326,570 S129T probably damaging Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Fyco1 A G 9: 123,794,833 V1377A probably damaging Het
Haus6 C T 4: 86,601,263 A203T possibly damaging Het
Hkdc1 T G 10: 62,417,933 D23A probably damaging Het
Hpdl C T 4: 116,820,578 V229M probably damaging Het
Hspa12a T C 19: 58,822,086 Y175C probably damaging Het
Hyal1 C T 9: 107,577,667 P59S probably damaging Het
Itpr1 G A 6: 108,510,738 C2374Y probably benign Het
Kmt2a A T 9: 44,847,842 Y114* probably null Het
Mc2r A T 18: 68,407,395 Y276N possibly damaging Het
Mc2r A T 18: 68,407,397 I275K probably damaging Het
Mlycd A G 8: 119,410,280 Y413C probably damaging Het
Mocs2 T G 13: 114,820,919 S86R probably damaging Het
Msx2 C A 13: 53,472,608 A35S probably benign Het
Olfr770 A T 10: 129,133,147 L207H probably damaging Het
Pla2g4f C A 2: 120,305,023 S390I probably damaging Het
Plcl1 C T 1: 55,695,989 A163V possibly damaging Het
Pnn T C 12: 59,071,819 V396A probably damaging Het
Rbmxl1 G A 8: 78,505,641 probably benign Het
Recql G T 6: 142,365,618 probably null Het
Rev3l T A 10: 39,823,093 N1195K probably benign Het
Sctr A G 1: 120,031,620 T98A probably damaging Het
Sdk1 T A 5: 141,936,048 D6E probably benign Het
Smpdl3a T A 10: 57,807,938 I264K possibly damaging Het
Spag6 A G 2: 18,731,993 I154V probably benign Het
Tbc1d12 A C 19: 38,882,683 T297P probably benign Het
Tgfb1 A G 7: 25,696,960 D226G probably benign Het
Ubr3 G T 2: 70,016,244 probably null Het
Ubr4 T C 4: 139,468,096 Y1210H probably damaging Het
Ubr5 T C 15: 38,006,541 T1157A probably benign Het
Vmn2r120 T G 17: 57,524,938 T284P probably benign Het
Vps13b G T 15: 35,794,035 A2286S probably damaging Het
Zcchc14 A T 8: 121,604,593 probably benign Het
Zfr2 T A 10: 81,243,713 V362E probably benign Het
Other mutations in Rfwd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02160:Rfwd3 APN 8 111273075 missense possibly damaging 0.53
IGL02193:Rfwd3 APN 8 111273015 utr 3 prime probably benign
IGL02282:Rfwd3 APN 8 111293982 splice site probably benign
IGL02903:Rfwd3 APN 8 111278229 missense probably benign 0.00
PIT4468001:Rfwd3 UTSW 8 111282720 missense probably benign 0.19
R0254:Rfwd3 UTSW 8 111294023 missense probably benign
R0279:Rfwd3 UTSW 8 111282733 missense probably benign 0.00
R0531:Rfwd3 UTSW 8 111293989 critical splice donor site probably null
R1137:Rfwd3 UTSW 8 111288242 missense probably damaging 0.99
R1164:Rfwd3 UTSW 8 111288242 missense probably damaging 0.99
R1168:Rfwd3 UTSW 8 111288242 missense probably damaging 0.99
R1191:Rfwd3 UTSW 8 111288242 missense probably damaging 0.99
R1192:Rfwd3 UTSW 8 111288242 missense probably damaging 0.99
R1258:Rfwd3 UTSW 8 111288242 missense probably damaging 0.99
R1259:Rfwd3 UTSW 8 111288242 missense probably damaging 0.99
R1260:Rfwd3 UTSW 8 111288242 missense probably damaging 0.99
R1261:Rfwd3 UTSW 8 111288242 missense probably damaging 0.99
R1439:Rfwd3 UTSW 8 111278288 missense probably damaging 1.00
R1579:Rfwd3 UTSW 8 111288242 missense probably damaging 0.99
R1580:Rfwd3 UTSW 8 111288242 missense probably damaging 0.99
R1581:Rfwd3 UTSW 8 111288242 missense probably damaging 0.99
R1727:Rfwd3 UTSW 8 111288242 missense probably damaging 0.99
R1763:Rfwd3 UTSW 8 111288242 missense probably damaging 0.99
R1774:Rfwd3 UTSW 8 111288242 missense probably damaging 0.99
R1785:Rfwd3 UTSW 8 111297402 missense probably benign 0.05
R1786:Rfwd3 UTSW 8 111297402 missense probably benign 0.05
R2059:Rfwd3 UTSW 8 111297495 missense probably benign 0.20
R2130:Rfwd3 UTSW 8 111297402 missense probably benign 0.05
R2132:Rfwd3 UTSW 8 111297402 missense probably benign 0.05
R2133:Rfwd3 UTSW 8 111297402 missense probably benign 0.05
R2145:Rfwd3 UTSW 8 111282613 missense probably benign
R2174:Rfwd3 UTSW 8 111283343 missense probably damaging 0.98
R3897:Rfwd3 UTSW 8 111288242 missense probably damaging 0.99
R4625:Rfwd3 UTSW 8 111276358 missense probably benign 0.01
R5121:Rfwd3 UTSW 8 111282753 splice site probably null
R5480:Rfwd3 UTSW 8 111273832 missense probably damaging 0.96
R7417:Rfwd3 UTSW 8 111273069 missense probably benign 0.03
Z1088:Rfwd3 UTSW 8 111297606 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATGATCCAGACGCTCCAGTC -3'
(R):5'- AGAAATGAGTTCTTGGCTTGC -3'

Sequencing Primer
(F):5'- GTCCCAGCATGTAAACAGATATCTC -3'
(R):5'- GCTTGCTTTTAAAGGCAGCATAG -3'
Posted On2016-12-15