Incidental Mutation 'R5781:Ubr5'
ID447752
Institutional Source Beutler Lab
Gene Symbol Ubr5
Ensembl Gene ENSMUSG00000037487
Gene Nameubiquitin protein ligase E3 component n-recognin 5
SynonymsEdd, 4432411E13Rik, Edd1
MMRRC Submission 043378-MU
Accession Numbers

NCBI RefSeq: NM_001081359.2, NM_001112721.1; MGI:1918040

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5781 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location37967328-38078854 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 38006541 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 1157 (T1157A)
Ref Sequence ENSEMBL: ENSMUSP00000105965 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110336] [ENSMUST00000226414]
Predicted Effect probably benign
Transcript: ENSMUST00000110336
AA Change: T1157A

PolyPhen 2 Score 0.274 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000105965
Gene: ENSMUSG00000037487
AA Change: T1157A

DomainStartEndE-ValueType
low complexity region 94 111 N/A INTRINSIC
low complexity region 129 156 N/A INTRINSIC
Pfam:E3_UbLigase_EDD 179 230 9.7e-35 PFAM
low complexity region 282 323 N/A INTRINSIC
low complexity region 614 628 N/A INTRINSIC
low complexity region 860 870 N/A INTRINSIC
low complexity region 933 950 N/A INTRINSIC
low complexity region 970 999 N/A INTRINSIC
low complexity region 1140 1151 N/A INTRINSIC
ZnF_UBR1 1177 1244 5.42e-27 SMART
low complexity region 1396 1405 N/A INTRINSIC
low complexity region 1524 1537 N/A INTRINSIC
low complexity region 1567 1613 N/A INTRINSIC
low complexity region 1641 1657 N/A INTRINSIC
low complexity region 1662 1687 N/A INTRINSIC
low complexity region 1726 1742 N/A INTRINSIC
low complexity region 1759 1789 N/A INTRINSIC
low complexity region 1879 1890 N/A INTRINSIC
low complexity region 1972 1983 N/A INTRINSIC
low complexity region 1986 1997 N/A INTRINSIC
Blast:HECTc 2271 2313 2e-6 BLAST
low complexity region 2329 2366 N/A INTRINSIC
PolyA 2389 2452 3.97e-33 SMART
HECTc 2432 2798 1e-151 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000226414
AA Change: T1163A

PolyPhen 2 Score 0.086 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000227143
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228101
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228504
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype Strain: 3052764
Lethality: E11-E12
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a progestin-induced protein, which belongs to the HECT (homology to E6-AP carboxyl terminus) family. The HECT family proteins function as E3 ubiquitin-protein ligases, targeting specific proteins for ubiquitin-mediated proteolysis. This gene is localized to chromosome 8q22 which is disrupted in a variety of cancers. This gene potentially has a role in regulation of cell proliferation or differentiation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display embryonic lethality during organogenesis, impaired growth of the allantois, failure or impairment of chorioallantoic fusion, impaired angiogenesis in the yolk sac and allantois, decreased cell proliferation, and increased apoptosis. [provided by MGI curators]
Allele List at MGI

All alleles(151) : Targeted(3) Gene trapped(148)

Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 A G 11: 110,101,987 L1617P probably damaging Het
Abhd16b T C 2: 181,494,154 V283A probably damaging Het
Adamts19 G T 18: 58,837,968 R208L possibly damaging Het
Adamts4 T C 1: 171,251,015 I56T possibly damaging Het
Alpk1 A C 3: 127,680,035 V773G possibly damaging Het
Arhgap10 G T 8: 77,450,707 Q100K possibly damaging Het
Arhgef18 T A 8: 3,439,439 probably null Het
Asb15 A T 6: 24,564,378 H277L probably benign Het
Ascc3 T A 10: 50,637,978 V291E probably damaging Het
Cnot6l A C 5: 96,086,165 V329G probably benign Het
Col14a1 A G 15: 55,423,512 T910A unknown Het
Dhdds G A 4: 133,996,830 L58F probably damaging Het
Dsc2 A G 18: 20,032,510 I846T probably benign Het
Evc A T 5: 37,326,570 S129T probably damaging Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Fyco1 A G 9: 123,794,833 V1377A probably damaging Het
Haus6 C T 4: 86,601,263 A203T possibly damaging Het
Hkdc1 T G 10: 62,417,933 D23A probably damaging Het
Hpdl C T 4: 116,820,578 V229M probably damaging Het
Hspa12a T C 19: 58,822,086 Y175C probably damaging Het
Hyal1 C T 9: 107,577,667 P59S probably damaging Het
Itpr1 G A 6: 108,510,738 C2374Y probably benign Het
Kmt2a A T 9: 44,847,842 Y114* probably null Het
Mc2r A T 18: 68,407,395 Y276N possibly damaging Het
Mc2r A T 18: 68,407,397 I275K probably damaging Het
Mlycd A G 8: 119,410,280 Y413C probably damaging Het
Mocs2 T G 13: 114,820,919 S86R probably damaging Het
Msx2 C A 13: 53,472,608 A35S probably benign Het
Olfr770 A T 10: 129,133,147 L207H probably damaging Het
Pla2g4f C A 2: 120,305,023 S390I probably damaging Het
Plcl1 C T 1: 55,695,989 A163V possibly damaging Het
Pnn T C 12: 59,071,819 V396A probably damaging Het
Rbmxl1 G A 8: 78,505,641 probably benign Het
Recql G T 6: 142,365,618 probably null Het
Rev3l T A 10: 39,823,093 N1195K probably benign Het
Rfwd3 G A 8: 111,273,084 T754M probably benign Het
Sctr A G 1: 120,031,620 T98A probably damaging Het
Sdk1 T A 5: 141,936,048 D6E probably benign Het
Smpdl3a T A 10: 57,807,938 I264K possibly damaging Het
Spag6 A G 2: 18,731,993 I154V probably benign Het
Tbc1d12 A C 19: 38,882,683 T297P probably benign Het
Tgfb1 A G 7: 25,696,960 D226G probably benign Het
Ubr3 G T 2: 70,016,244 probably null Het
Ubr4 T C 4: 139,468,096 Y1210H probably damaging Het
Vmn2r120 T G 17: 57,524,938 T284P probably benign Het
Vps13b G T 15: 35,794,035 A2286S probably damaging Het
Zcchc14 A T 8: 121,604,593 probably benign Het
Zfr2 T A 10: 81,243,713 V362E probably benign Het
Other mutations in Ubr5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Ubr5 APN 15 37984036 missense probably damaging 1.00
IGL00548:Ubr5 APN 15 38004321 missense probably benign 0.11
IGL00675:Ubr5 APN 15 38018284 missense possibly damaging 0.84
IGL00770:Ubr5 APN 15 38006541 missense probably benign 0.27
IGL00774:Ubr5 APN 15 38006541 missense probably benign 0.27
IGL00919:Ubr5 APN 15 38040842 missense probably damaging 1.00
IGL00962:Ubr5 APN 15 37985934 missense probably damaging 1.00
IGL01328:Ubr5 APN 15 37981523 missense possibly damaging 0.82
IGL01359:Ubr5 APN 15 37973006 missense probably damaging 0.96
IGL01394:Ubr5 APN 15 38009631 missense possibly damaging 0.90
IGL01674:Ubr5 APN 15 37998379 missense probably damaging 1.00
IGL01981:Ubr5 APN 15 37996598 missense probably benign 0.08
IGL01993:Ubr5 APN 15 37973012 missense probably damaging 0.99
IGL02159:Ubr5 APN 15 37991379 splice site probably benign
IGL02252:Ubr5 APN 15 38024894 missense probably damaging 1.00
IGL02442:Ubr5 APN 15 38037901 missense possibly damaging 0.95
IGL02502:Ubr5 APN 15 38030689 missense probably benign 0.01
IGL02503:Ubr5 APN 15 38018320 missense possibly damaging 0.90
IGL02503:Ubr5 APN 15 38018314 missense probably damaging 0.99
IGL02546:Ubr5 APN 15 38008747 missense probably benign 0.00
IGL02556:Ubr5 APN 15 38002448 missense probably benign 0.18
IGL02647:Ubr5 APN 15 37992082 missense probably damaging 0.99
IGL02679:Ubr5 APN 15 38002314 missense probably benign 0.36
IGL02726:Ubr5 APN 15 38000562 splice site probably benign
IGL02884:Ubr5 APN 15 37998376 missense probably damaging 1.00
IGL02972:Ubr5 APN 15 38041952 missense probably damaging 1.00
IGL03000:Ubr5 APN 15 38024852 missense probably damaging 0.99
IGL03028:Ubr5 APN 15 38047593 missense probably benign 0.00
IGL03057:Ubr5 APN 15 38040906 splice site probably benign
IGL03085:Ubr5 APN 15 38029568 missense probably damaging 1.00
IGL03198:Ubr5 APN 15 38045720 missense probably damaging 1.00
IGL03368:Ubr5 APN 15 37998316 missense probably damaging 0.96
P0016:Ubr5 UTSW 15 38000578 missense probably damaging 1.00
PIT4142001:Ubr5 UTSW 15 38041909 missense probably damaging 0.98
R0133:Ubr5 UTSW 15 37996571 missense probably damaging 0.98
R0173:Ubr5 UTSW 15 38004675 missense probably damaging 1.00
R0234:Ubr5 UTSW 15 37968493 missense probably damaging 1.00
R0234:Ubr5 UTSW 15 37968493 missense probably damaging 1.00
R0314:Ubr5 UTSW 15 37997187 missense probably damaging 0.99
R0379:Ubr5 UTSW 15 38018957 missense probably benign 0.00
R0390:Ubr5 UTSW 15 38030672 missense probably benign 0.19
R0415:Ubr5 UTSW 15 37972980 missense probably damaging 0.98
R0531:Ubr5 UTSW 15 37991344 missense probably benign 0.34
R0650:Ubr5 UTSW 15 38030807 splice site probably benign
R0720:Ubr5 UTSW 15 37972991 missense probably damaging 0.98
R1183:Ubr5 UTSW 15 37997175 missense possibly damaging 0.71
R1302:Ubr5 UTSW 15 38041479 missense possibly damaging 0.91
R1442:Ubr5 UTSW 15 38014924 splice site probably benign
R1507:Ubr5 UTSW 15 37980870 missense probably damaging 1.00
R1575:Ubr5 UTSW 15 38040841 missense probably damaging 1.00
R1577:Ubr5 UTSW 15 38030730 missense possibly damaging 0.76
R1622:Ubr5 UTSW 15 38009113 unclassified probably benign
R1721:Ubr5 UTSW 15 38041846 missense probably benign 0.18
R1799:Ubr5 UTSW 15 37989377 missense probably damaging 1.00
R1840:Ubr5 UTSW 15 37980917 missense possibly damaging 0.51
R1867:Ubr5 UTSW 15 38041846 missense probably benign 0.18
R1868:Ubr5 UTSW 15 38041846 missense probably benign 0.18
R2065:Ubr5 UTSW 15 38040842 missense probably damaging 1.00
R2107:Ubr5 UTSW 15 37989302 missense probably benign 0.00
R2201:Ubr5 UTSW 15 38002299 missense possibly damaging 0.83
R2261:Ubr5 UTSW 15 37988284 missense probably damaging 0.99
R2441:Ubr5 UTSW 15 37989345 missense probably damaging 0.99
R2512:Ubr5 UTSW 15 38002319 missense probably damaging 1.00
R3008:Ubr5 UTSW 15 38030845 missense probably benign
R3412:Ubr5 UTSW 15 38004235 splice site probably benign
R3898:Ubr5 UTSW 15 37997739 missense probably benign 0.02
R3900:Ubr5 UTSW 15 38019242 missense probably damaging 1.00
R4032:Ubr5 UTSW 15 38024837 missense probably benign 0.22
R4352:Ubr5 UTSW 15 38041573 missense probably benign 0.31
R4362:Ubr5 UTSW 15 38078403 missense probably damaging 0.99
R4467:Ubr5 UTSW 15 38004336 missense probably damaging 1.00
R4507:Ubr5 UTSW 15 38013542 missense probably damaging 0.96
R4683:Ubr5 UTSW 15 38037967 missense probably damaging 1.00
R4771:Ubr5 UTSW 15 38018297 missense possibly damaging 0.50
R4878:Ubr5 UTSW 15 38006564 missense probably benign 0.01
R4999:Ubr5 UTSW 15 38009668 missense probably benign 0.06
R5057:Ubr5 UTSW 15 38004109 missense probably damaging 0.98
R5177:Ubr5 UTSW 15 38006517 missense probably benign 0.22
R5186:Ubr5 UTSW 15 37997916 missense probably damaging 0.99
R5378:Ubr5 UTSW 15 37989578 missense probably damaging 1.00
R5486:Ubr5 UTSW 15 38008739 missense probably benign 0.00
R5494:Ubr5 UTSW 15 38019281 missense possibly damaging 0.78
R5617:Ubr5 UTSW 15 38030657 missense possibly damaging 0.47
R5636:Ubr5 UTSW 15 37983996 missense probably damaging 1.00
R5655:Ubr5 UTSW 15 38015093 missense probably damaging 0.99
R5715:Ubr5 UTSW 15 38002233 missense probably benign 0.06
R6645:Ubr5 UTSW 15 38029506 missense probably damaging 1.00
R6774:Ubr5 UTSW 15 38015135 missense probably damaging 1.00
R6823:Ubr5 UTSW 15 37989598 missense probably benign 0.08
R6877:Ubr5 UTSW 15 38002570 missense probably damaging 0.98
R7105:Ubr5 UTSW 15 38008775 missense not run
X0024:Ubr5 UTSW 15 37992060 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACGTTTACATACTTTCAGCTCACG -3'
(R):5'- GCAAGATCTCTGGAAATGTGAGTG -3'

Sequencing Primer
(F):5'- TACTTTCAGCTCACGTCAAAGGAGG -3'
(R):5'- TGTGGATGAGCCTCTCCAG -3'
Posted On2016-12-15