Incidental Mutation 'R5781:Col14a1'
ID447753
Institutional Source Beutler Lab
Gene Symbol Col14a1
Ensembl Gene ENSMUSG00000022371
Gene Namecollagen, type XIV, alpha 1
Synonyms5730412L22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5781 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location55307750-55520803 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 55423512 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 910 (T910A)
Ref Sequence ENSEMBL: ENSMUSP00000105850 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023053] [ENSMUST00000110217] [ENSMUST00000110221]
Predicted Effect unknown
Transcript: ENSMUST00000023053
AA Change: T913A
SMART Domains Protein: ENSMUSP00000023053
Gene: ENSMUSG00000022371
AA Change: T913A

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
FN3 30 108 5.4e-7 SMART
low complexity region 122 136 N/A INTRINSIC
VWA 157 336 9.5e-56 SMART
FN3 354 434 3.82e-7 SMART
FN3 444 522 3.1e-7 SMART
FN3 536 613 5.07e-12 SMART
FN3 625 704 3.1e-7 SMART
FN3 736 818 6.2e-7 SMART
FN3 830 909 1.45e-7 SMART
FN3 920 999 3.59e0 SMART
low complexity region 1010 1022 N/A INTRINSIC
VWA 1031 1211 2.02e-59 SMART
TSPN 1230 1425 1.19e-66 SMART
Pfam:Collagen 1461 1515 2.9e-8 PFAM
Pfam:Collagen 1513 1571 6.3e-9 PFAM
Pfam:Collagen 1555 1615 8.5e-10 PFAM
Pfam:Collagen 1653 1709 7.6e-10 PFAM
Pfam:Collagen 1707 1762 2.6e-7 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000110217
AA Change: T914A
SMART Domains Protein: ENSMUSP00000105846
Gene: ENSMUSG00000022371
AA Change: T914A

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
FN3 30 108 5.4e-7 SMART
low complexity region 122 136 N/A INTRINSIC
VWA 157 336 9.5e-56 SMART
FN3 354 434 3.82e-7 SMART
FN3 444 522 3.1e-7 SMART
FN3 536 613 5.07e-12 SMART
FN3 625 704 3.1e-7 SMART
FN3 736 819 5.4e-7 SMART
FN3 831 910 1.45e-7 SMART
FN3 921 1000 3.59e0 SMART
low complexity region 1011 1023 N/A INTRINSIC
VWA 1032 1212 2.02e-59 SMART
TSPN 1231 1426 1.19e-66 SMART
Pfam:Collagen 1462 1516 2.5e-8 PFAM
Pfam:Collagen 1514 1572 5.4e-9 PFAM
Pfam:Collagen 1556 1616 7.3e-10 PFAM
Pfam:Collagen 1654 1710 6.5e-10 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000110221
AA Change: T910A
SMART Domains Protein: ENSMUSP00000105850
Gene: ENSMUSG00000022371
AA Change: T910A

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
FN3 30 108 5.4e-7 SMART
low complexity region 122 136 N/A INTRINSIC
VWA 157 336 9.5e-56 SMART
FN3 354 434 3.82e-7 SMART
FN3 444 522 3.1e-7 SMART
FN3 536 613 5.07e-12 SMART
FN3 625 704 3.1e-7 SMART
FN3 736 815 7.12e-7 SMART
FN3 827 906 1.45e-7 SMART
FN3 917 996 3.59e0 SMART
low complexity region 1007 1019 N/A INTRINSIC
VWA 1028 1208 2.02e-59 SMART
TSPN 1227 1422 1.19e-66 SMART
Pfam:Collagen 1458 1512 8.2e-9 PFAM
Pfam:Collagen 1510 1568 1.8e-9 PFAM
Pfam:Collagen 1552 1612 2.4e-10 PFAM
Pfam:Collagen 1650 1706 2.2e-10 PFAM
Pfam:Collagen 1704 1759 7.5e-8 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha chain of type XIV collagen, a member of the FACIT (fibril-associated collagens with interrupted triple helices) collagen family. Type XIV collagen interacts with the fibril surface and is involved in the regulation of fibrillogenesis. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a null mutation display abnormal tendon morphology and abnormal biomechanical properties of the skin and tendons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 A G 11: 110,101,987 L1617P probably damaging Het
Abhd16b T C 2: 181,494,154 V283A probably damaging Het
Adamts19 G T 18: 58,837,968 R208L possibly damaging Het
Adamts4 T C 1: 171,251,015 I56T possibly damaging Het
Alpk1 A C 3: 127,680,035 V773G possibly damaging Het
Arhgap10 G T 8: 77,450,707 Q100K possibly damaging Het
Arhgef18 T A 8: 3,439,439 probably null Het
Asb15 A T 6: 24,564,378 H277L probably benign Het
Ascc3 T A 10: 50,637,978 V291E probably damaging Het
Cnot6l A C 5: 96,086,165 V329G probably benign Het
Dhdds G A 4: 133,996,830 L58F probably damaging Het
Dsc2 A G 18: 20,032,510 I846T probably benign Het
Evc A T 5: 37,326,570 S129T probably damaging Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Fyco1 A G 9: 123,794,833 V1377A probably damaging Het
Haus6 C T 4: 86,601,263 A203T possibly damaging Het
Hkdc1 T G 10: 62,417,933 D23A probably damaging Het
Hpdl C T 4: 116,820,578 V229M probably damaging Het
Hspa12a T C 19: 58,822,086 Y175C probably damaging Het
Hyal1 C T 9: 107,577,667 P59S probably damaging Het
Itpr1 G A 6: 108,510,738 C2374Y probably benign Het
Kmt2a A T 9: 44,847,842 Y114* probably null Het
Mc2r A T 18: 68,407,395 Y276N possibly damaging Het
Mc2r A T 18: 68,407,397 I275K probably damaging Het
Mlycd A G 8: 119,410,280 Y413C probably damaging Het
Mocs2 T G 13: 114,820,919 S86R probably damaging Het
Msx2 C A 13: 53,472,608 A35S probably benign Het
Olfr770 A T 10: 129,133,147 L207H probably damaging Het
Pla2g4f C A 2: 120,305,023 S390I probably damaging Het
Plcl1 C T 1: 55,695,989 A163V possibly damaging Het
Pnn T C 12: 59,071,819 V396A probably damaging Het
Rbmxl1 G A 8: 78,505,641 probably benign Het
Recql G T 6: 142,365,618 probably null Het
Rev3l T A 10: 39,823,093 N1195K probably benign Het
Rfwd3 G A 8: 111,273,084 T754M probably benign Het
Sctr A G 1: 120,031,620 T98A probably damaging Het
Sdk1 T A 5: 141,936,048 D6E probably benign Het
Smpdl3a T A 10: 57,807,938 I264K possibly damaging Het
Spag6 A G 2: 18,731,993 I154V probably benign Het
Tbc1d12 A C 19: 38,882,683 T297P probably benign Het
Tgfb1 A G 7: 25,696,960 D226G probably benign Het
Ubr3 G T 2: 70,016,244 probably null Het
Ubr4 T C 4: 139,468,096 Y1210H probably damaging Het
Ubr5 T C 15: 38,006,541 T1157A probably benign Het
Vmn2r120 T G 17: 57,524,938 T284P probably benign Het
Vps13b G T 15: 35,794,035 A2286S probably damaging Het
Zcchc14 A T 8: 121,604,593 probably benign Het
Zfr2 T A 10: 81,243,713 V362E probably benign Het
Other mutations in Col14a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00663:Col14a1 APN 15 55411585 missense unknown
IGL01290:Col14a1 APN 15 55423507 missense unknown
IGL01300:Col14a1 APN 15 55467976 missense unknown
IGL01505:Col14a1 APN 15 55455223 missense unknown
IGL01533:Col14a1 APN 15 55420840 missense unknown
IGL01563:Col14a1 APN 15 55487941 missense unknown
IGL01650:Col14a1 APN 15 55406693 missense unknown
IGL01659:Col14a1 APN 15 55446172 unclassified probably benign
IGL01670:Col14a1 APN 15 55329266 missense unknown
IGL01760:Col14a1 APN 15 55423459 missense unknown
IGL01803:Col14a1 APN 15 55418814 missense unknown
IGL01966:Col14a1 APN 15 55448725 unclassified probably benign
IGL01990:Col14a1 APN 15 55363463 missense unknown
IGL02124:Col14a1 APN 15 55463703 missense unknown
IGL02138:Col14a1 APN 15 55420835 missense unknown
IGL02192:Col14a1 APN 15 55362402 missense unknown
IGL02326:Col14a1 APN 15 55418797 missense unknown
IGL02335:Col14a1 APN 15 55463769 splice site probably benign
IGL02407:Col14a1 APN 15 55448876 splice site probably benign
IGL02486:Col14a1 APN 15 55388696 splice site probably benign
IGL02537:Col14a1 APN 15 55344914 nonsense probably null
IGL02567:Col14a1 APN 15 55344961 critical splice donor site probably null
IGL02643:Col14a1 APN 15 55420862 missense unknown
IGL02669:Col14a1 APN 15 55418782 missense unknown
IGL02673:Col14a1 APN 15 55418782 missense unknown
IGL02674:Col14a1 APN 15 55418782 missense unknown
IGL03201:Col14a1 APN 15 55408904 missense unknown
IGL03334:Col14a1 APN 15 55448821 unclassified probably benign
IGL03370:Col14a1 APN 15 55488541 splice site probably null
IGL03385:Col14a1 APN 15 55410204 missense unknown
IGL03385:Col14a1 APN 15 55471708 missense unknown
PIT4131001:Col14a1 UTSW 15 55448876 splice site probably benign
R0046:Col14a1 UTSW 15 55408963 splice site probably benign
R0046:Col14a1 UTSW 15 55408963 splice site probably benign
R0173:Col14a1 UTSW 15 55488532 missense probably damaging 1.00
R0242:Col14a1 UTSW 15 55497511 missense probably damaging 1.00
R0242:Col14a1 UTSW 15 55497511 missense probably damaging 1.00
R0359:Col14a1 UTSW 15 55407868 splice site probably benign
R0391:Col14a1 UTSW 15 55446259 unclassified probably benign
R0468:Col14a1 UTSW 15 55388646 missense unknown
R0652:Col14a1 UTSW 15 55344882 missense unknown
R0692:Col14a1 UTSW 15 55341738 missense unknown
R0745:Col14a1 UTSW 15 55338417 missense unknown
R1006:Col14a1 UTSW 15 55519935 missense probably benign 0.04
R1331:Col14a1 UTSW 15 55410188 missense unknown
R1537:Col14a1 UTSW 15 55380767 missense unknown
R1557:Col14a1 UTSW 15 55388579 missense unknown
R1721:Col14a1 UTSW 15 55447462 unclassified probably benign
R1737:Col14a1 UTSW 15 55344961 critical splice donor site probably benign
R1837:Col14a1 UTSW 15 55382495 missense unknown
R1867:Col14a1 UTSW 15 55447462 unclassified probably benign
R1868:Col14a1 UTSW 15 55447462 unclassified probably benign
R1991:Col14a1 UTSW 15 55449940 missense unknown
R2020:Col14a1 UTSW 15 55446181 unclassified probably benign
R2103:Col14a1 UTSW 15 55449940 missense unknown
R2116:Col14a1 UTSW 15 55407764 missense unknown
R2163:Col14a1 UTSW 15 55444645 unclassified probably benign
R2207:Col14a1 UTSW 15 55463686 missense unknown
R2215:Col14a1 UTSW 15 55380842 missense unknown
R2264:Col14a1 UTSW 15 55466690 splice site probably null
R2383:Col14a1 UTSW 15 55447517 unclassified probably benign
R2397:Col14a1 UTSW 15 55338439 missense unknown
R2422:Col14a1 UTSW 15 55449922 missense unknown
R3793:Col14a1 UTSW 15 55363513 missense unknown
R4082:Col14a1 UTSW 15 55437033 missense unknown
R4112:Col14a1 UTSW 15 55363559 missense unknown
R4519:Col14a1 UTSW 15 55388579 missense unknown
R4628:Col14a1 UTSW 15 55449833 nonsense probably null
R4692:Col14a1 UTSW 15 55423468 missense unknown
R4696:Col14a1 UTSW 15 55372602 missense unknown
R4749:Col14a1 UTSW 15 55452336 missense unknown
R5324:Col14a1 UTSW 15 55338445 missense unknown
R5382:Col14a1 UTSW 15 55362436 missense unknown
R5634:Col14a1 UTSW 15 55518298 missense probably damaging 1.00
R5828:Col14a1 UTSW 15 55436976 missense unknown
R5873:Col14a1 UTSW 15 55445786 unclassified probably benign
R5966:Col14a1 UTSW 15 55452383 critical splice donor site probably null
R6106:Col14a1 UTSW 15 55520008 missense probably damaging 1.00
R6135:Col14a1 UTSW 15 55380850 missense unknown
R6319:Col14a1 UTSW 15 55516169 missense probably damaging 0.99
R6475:Col14a1 UTSW 15 55445822 unclassified probably benign
R6540:Col14a1 UTSW 15 55372581 missense unknown
R6893:Col14a1 UTSW 15 55444648 unclassified probably benign
X0023:Col14a1 UTSW 15 55423447 missense unknown
X0063:Col14a1 UTSW 15 55410215 missense unknown
Predicted Primers PCR Primer
(F):5'- CTAAGAGCACATGCATGTTGTGAC -3'
(R):5'- TGCCTGCCAACTAGAACTCTG -3'

Sequencing Primer
(F):5'- AGCACATGCATGTTGTGACTGTAG -3'
(R):5'- TAGAACTCTGGACAGCCCTG -3'
Posted On2016-12-15