Incidental Mutation 'R5783:Sybu'
ID447882
Institutional Source Beutler Lab
Gene Symbol Sybu
Ensembl Gene ENSMUSG00000022340
Gene Namesyntabulin (syntaxin-interacting)
SynonymsA830027B17Rik, Golsyn/Syntabulin, 5730410E15Rik
MMRRC Submission 043380-MU
Accession Numbers

Genbank: NM_176998 ; MGI: 2442392

Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R5783 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location44671856-44788063 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 44746414 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 153 (I153V)
Ref Sequence ENSEMBL: ENSMUSP00000087511 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090057] [ENSMUST00000110267] [ENSMUST00000110269] [ENSMUST00000226214] [ENSMUST00000227305] [ENSMUST00000228057]
Predicted Effect probably damaging
Transcript: ENSMUST00000090057
AA Change: I153V

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000087511
Gene: ENSMUSG00000022340
AA Change: I153V

DomainStartEndE-ValueType
low complexity region 51 61 N/A INTRINSIC
low complexity region 112 120 N/A INTRINSIC
low complexity region 148 163 N/A INTRINSIC
low complexity region 174 205 N/A INTRINSIC
low complexity region 264 275 N/A INTRINSIC
low complexity region 276 290 N/A INTRINSIC
low complexity region 320 331 N/A INTRINSIC
Pfam:Syntaphilin 343 638 3.5e-142 PFAM
low complexity region 738 755 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000110267
AA Change: I25V

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000105896
Gene: ENSMUSG00000022340
AA Change: I25V

DomainStartEndE-ValueType
low complexity region 20 35 N/A INTRINSIC
low complexity region 46 77 N/A INTRINSIC
low complexity region 136 147 N/A INTRINSIC
low complexity region 148 162 N/A INTRINSIC
low complexity region 192 203 N/A INTRINSIC
Pfam:Syntaphilin 214 511 5.8e-140 PFAM
low complexity region 610 627 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110269
SMART Domains Protein: ENSMUSP00000105898
Gene: ENSMUSG00000022340

DomainStartEndE-ValueType
low complexity region 64 75 N/A INTRINSIC
low complexity region 76 90 N/A INTRINSIC
low complexity region 120 131 N/A INTRINSIC
Pfam:Syntaphilin 142 439 4.4e-140 PFAM
low complexity region 538 555 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000226214
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226825
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227081
Predicted Effect possibly damaging
Transcript: ENSMUST00000227305
AA Change: I24V

PolyPhen 2 Score 0.903 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000228057
AA Change: I25V

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Syntabulin/GOLSYN is part of a kinesin motor-adaptor complex that is critical for the anterograde axonal transport of active zone components and contributes to activity-dependent presynaptic assembly during neuronal development (Cai et al., 2007 [PubMed 17611281]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700093K21Rik T A 11: 23,518,787 Y48F probably damaging Het
4930402H24Rik A C 2: 130,739,083 F582L possibly damaging Het
AI481877 A T 4: 59,076,239 L568* probably null Het
Apob A G 12: 8,001,022 D1082G probably damaging Het
Cald1 G A 6: 34,753,533 A236T possibly damaging Het
Ccdc88b A C 19: 6,853,916 C553G probably benign Het
Cenpe A G 3: 135,261,580 D2161G probably benign Het
Cep78 G T 19: 15,956,359 N618K probably benign Het
Chka A G 19: 3,864,661 N118D probably damaging Het
Dennd5a A C 7: 109,894,636 I1263S probably damaging Het
Dnm3 T C 1: 162,355,471 T92A possibly damaging Het
Dpp9 T C 17: 56,211,655 K50E probably damaging Het
Fen1 G T 19: 10,200,830 Y83* probably null Het
Gm1110 A G 9: 26,882,336 I532T probably benign Het
Hist2h2be T C 3: 96,221,299 V45A possibly damaging Het
Impdh1 A T 6: 29,206,343 F140Y possibly damaging Het
Kcnc4 T C 3: 107,447,872 D420G possibly damaging Het
Kctd19 A G 8: 105,386,980 V664A probably benign Het
Krt80 C T 15: 101,359,479 probably null Het
Lars2 T G 9: 123,461,596 M876R probably benign Het
Lrrc9 A G 12: 72,456,053 E266G possibly damaging Het
Mesd T A 7: 83,895,675 V120E probably damaging Het
Mogs C T 6: 83,118,671 T823I probably damaging Het
Mrgprh C A 17: 12,877,446 T191N probably benign Het
Mtss1 C T 15: 58,943,524 S729N probably benign Het
Muc5b G T 7: 141,858,428 E1704* probably null Het
Olfr1076 T C 2: 86,508,638 Y60H probably damaging Het
Olfr631 A T 7: 103,928,942 I40F probably damaging Het
Olfr695 C A 7: 106,873,334 V304F probably damaging Het
Osbpl8 T A 10: 111,267,783 L216* probably null Het
Pcdha5 T C 18: 36,962,481 V681A probably benign Het
Pgap3 A C 11: 98,390,464 V190G probably benign Het
Ppp2r5a A T 1: 191,354,640 Y373N probably damaging Het
Prkdc T C 16: 15,717,801 L1675P probably damaging Het
Rapgef2 T G 3: 79,087,993 I635L probably benign Het
Rusc1 T C 3: 89,088,145 D193G probably damaging Het
Ryr3 C T 2: 112,652,998 V4140I probably benign Het
Scamp5 A G 9: 57,446,070 probably null Het
Slc41a3 T C 6: 90,619,542 I31T probably benign Het
Smad9 T C 3: 54,794,442 V368A probably benign Het
Smim8 TTTAATGAAGAGCT TT 4: 34,771,261 probably benign Het
St8sia1 T C 6: 142,963,614 N52S possibly damaging Het
Svop T G 5: 114,064,935 D72A possibly damaging Het
Tmem266 G T 9: 55,397,803 S32I probably damaging Het
Trpm4 G T 7: 45,310,389 R694S probably benign Het
Uqcrfs1 A G 13: 30,545,204 L15P probably damaging Het
Vrtn T A 12: 84,650,477 L667Q probably benign Het
Zc3h14 T A 12: 98,757,175 S241R probably damaging Het
Zfp318 TGAAGAAGAAGAAGAAGAAGAAGAAGAAG TGAAGAAGAAGAAGAAGAAGAAG 17: 46,412,514 probably benign Het
Zfp617 C A 8: 71,932,464 H213N probably damaging Het
Zfp638 G A 6: 83,944,847 G652D possibly damaging Het
Zmiz2 T C 11: 6,405,081 L916P probably damaging Het
Other mutations in Sybu
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01453:Sybu APN 15 44672805 missense probably damaging 1.00
IGL02211:Sybu APN 15 44673466 missense probably damaging 1.00
IGL02303:Sybu APN 15 44673223 missense probably benign 0.03
E7848:Sybu UTSW 15 44673422 missense probably benign 0.32
R0015:Sybu UTSW 15 44673500 missense probably damaging 0.99
R0015:Sybu UTSW 15 44673500 missense probably damaging 0.99
R0064:Sybu UTSW 15 44672993 missense probably benign 0.00
R0064:Sybu UTSW 15 44672993 missense probably benign 0.00
R0413:Sybu UTSW 15 44673272 missense probably damaging 1.00
R0650:Sybu UTSW 15 44673268 missense probably benign 0.08
R1147:Sybu UTSW 15 44746255 missense probably damaging 1.00
R1147:Sybu UTSW 15 44746255 missense probably damaging 1.00
R1307:Sybu UTSW 15 44675390 missense probably damaging 1.00
R1568:Sybu UTSW 15 44718832 nonsense probably null
R2112:Sybu UTSW 15 44673335 missense probably benign 0.06
R2967:Sybu UTSW 15 44746356 missense probably damaging 1.00
R3120:Sybu UTSW 15 44672959 missense possibly damaging 0.88
R3429:Sybu UTSW 15 44746458 missense probably damaging 0.98
R3508:Sybu UTSW 15 44673082 missense probably damaging 1.00
R3720:Sybu UTSW 15 44672632 missense possibly damaging 0.89
R4080:Sybu UTSW 15 44718943 missense probably damaging 1.00
R4898:Sybu UTSW 15 44675499 missense probably benign 0.02
R4975:Sybu UTSW 15 44677667 missense probably damaging 1.00
R5066:Sybu UTSW 15 44677644 missense probably damaging 1.00
R5913:Sybu UTSW 15 44787621 missense probably damaging 1.00
R6977:Sybu UTSW 15 44677695 missense probably benign 0.00
R7044:Sybu UTSW 15 44677695 missense possibly damaging 0.79
R7139:Sybu UTSW 15 44677714 missense possibly damaging 0.93
R7328:Sybu UTSW 15 44787794 missense not run
R7543:Sybu UTSW 15 44683452 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- AATTCTAGCTGAGAGGCCAC -3'
(R):5'- AACATAGTCACAGACTGCTGGAC -3'

Sequencing Primer
(F):5'- CATAGCCTTAGTGTACCTGAGCAG -3'
(R):5'- ATAGTCACAGACTGCTGGACTGTTC -3'
Posted On2016-12-15