Incidental Mutation 'R5785:Apbb1'
ID447960
Institutional Source Beutler Lab
Gene Symbol Apbb1
Ensembl Gene ENSMUSG00000037032
Gene Nameamyloid beta (A4) precursor protein-binding, family B, member 1
SynonymsFe65, Rir
MMRRC Submission 043206-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5785 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location105558483-105581653 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 105567715 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Tyrosine at position 254 (D254Y)
Ref Sequence ENSEMBL: ENSMUSP00000140116 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081165] [ENSMUST00000186814] [ENSMUST00000186868] [ENSMUST00000187051] [ENSMUST00000187057] [ENSMUST00000187683] [ENSMUST00000187721] [ENSMUST00000188001] [ENSMUST00000188368] [ENSMUST00000188440] [ENSMUST00000189072] [ENSMUST00000189265] [ENSMUST00000189378] [ENSMUST00000190369] [ENSMUST00000191011] [ENSMUST00000191601] [ENSMUST00000210079]
Predicted Effect probably damaging
Transcript: ENSMUST00000081165
AA Change: D254Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000079932
Gene: ENSMUSG00000037032
AA Change: D254Y

DomainStartEndE-ValueType
low complexity region 146 184 N/A INTRINSIC
WW 254 285 6.23e-5 SMART
low complexity region 287 299 N/A INTRINSIC
PTB 365 512 4.16e-38 SMART
PTB 538 667 1.76e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186814
Predicted Effect probably benign
Transcript: ENSMUST00000186868
SMART Domains Protein: ENSMUSP00000140052
Gene: ENSMUSG00000037032

DomainStartEndE-ValueType
Pfam:WW 1 24 1.1e-5 PFAM
low complexity region 28 40 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000187051
SMART Domains Protein: ENSMUSP00000139755
Gene: ENSMUSG00000037032

DomainStartEndE-ValueType
Pfam:WW 1 24 1.4e-5 PFAM
low complexity region 28 40 N/A INTRINSIC
SCOP:d1shca_ 74 120 9e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000187057
AA Change: D31Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139899
Gene: ENSMUSG00000037032
AA Change: D31Y

DomainStartEndE-ValueType
WW 31 62 3.7e-7 SMART
low complexity region 64 76 N/A INTRINSIC
PTB 142 287 3.8e-41 SMART
PTB 313 442 9.5e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000187683
SMART Domains Protein: ENSMUSP00000139426
Gene: ENSMUSG00000037032

DomainStartEndE-ValueType
Pfam:WW 1 24 2.1e-5 PFAM
low complexity region 28 40 N/A INTRINSIC
Pfam:PID 111 158 5.9e-6 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000187721
AA Change: D54Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140192
Gene: ENSMUSG00000037032
AA Change: D54Y

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
WW 54 85 3.7e-7 SMART
low complexity region 87 99 N/A INTRINSIC
Pfam:PID 170 242 1.5e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188001
Predicted Effect probably damaging
Transcript: ENSMUST00000188368
AA Change: D31Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139788
Gene: ENSMUSG00000037032
AA Change: D31Y

DomainStartEndE-ValueType
WW 31 62 3.7e-7 SMART
low complexity region 64 76 N/A INTRINSIC
PTB 142 289 1.8e-40 SMART
PTB 315 444 9.5e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188440
SMART Domains Protein: ENSMUSP00000140715
Gene: ENSMUSG00000037032

DomainStartEndE-ValueType
Pfam:WW 1 24 3.4e-5 PFAM
low complexity region 28 40 N/A INTRINSIC
PTB 106 223 1.4e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000189072
SMART Domains Protein: ENSMUSP00000139575
Gene: ENSMUSG00000037032

DomainStartEndE-ValueType
Pfam:WW 1 24 8.1e-5 PFAM
low complexity region 28 40 N/A INTRINSIC
PTB 106 253 1.8e-40 SMART
PTB 279 408 9.5e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000189265
SMART Domains Protein: ENSMUSP00000140137
Gene: ENSMUSG00000037032

DomainStartEndE-ValueType
Pfam:PID 1 34 2.3e-6 PFAM
PTB 63 192 9.5e-39 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000189378
AA Change: D254Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140979
Gene: ENSMUSG00000037032
AA Change: D254Y

DomainStartEndE-ValueType
low complexity region 146 184 N/A INTRINSIC
WW 254 285 6.23e-5 SMART
low complexity region 287 299 N/A INTRINSIC
PTB 365 510 6.86e-39 SMART
PTB 536 665 1.76e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190369
SMART Domains Protein: ENSMUSP00000140486
Gene: ENSMUSG00000037032

DomainStartEndE-ValueType
Pfam:WW 1 24 8.1e-5 PFAM
low complexity region 28 40 N/A INTRINSIC
PTB 106 253 1.8e-40 SMART
PTB 279 408 9.5e-39 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190961
Predicted Effect probably damaging
Transcript: ENSMUST00000191011
AA Change: D254Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140973
Gene: ENSMUSG00000037032
AA Change: D254Y

DomainStartEndE-ValueType
low complexity region 146 184 N/A INTRINSIC
WW 254 285 6.23e-5 SMART
low complexity region 287 299 N/A INTRINSIC
PTB 365 510 6.86e-39 SMART
PTB 536 665 1.76e-36 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191250
Predicted Effect probably damaging
Transcript: ENSMUST00000191601
AA Change: D254Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140116
Gene: ENSMUSG00000037032
AA Change: D254Y

DomainStartEndE-ValueType
low complexity region 146 184 N/A INTRINSIC
WW 254 285 3.7e-7 SMART
low complexity region 287 299 N/A INTRINSIC
PTB 365 512 1.8e-40 SMART
PTB 538 667 9.5e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000210079
Predicted Effect probably benign
Transcript: ENSMUST00000211614
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Fe65 protein family. It is an adaptor protein localized in the nucleus. It interacts with the Alzheimer's disease amyloid precursor protein (APP), transcription factor CP2/LSF/LBP1 and the low-density lipoprotein receptor-related protein. APP functions as a cytosolic anchoring site that can prevent the gene product's nuclear translocation. This encoded protein could play an important role in the pathogenesis of Alzheimer's disease. It is thought to regulate transcription. Also it is observed to block cell cycle progression by downregulating thymidylate synthase expression. Multiple alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Mar 2012]
PHENOTYPE: Homozygotes for a null allele are hypersensitive to ionizing radiation while mouse embryonic fibroblasts are hypersensitive to DNA damaging agents. Homozygotes for a second null allele display impaired performance in learning and memory tasks, with a striking deficit in reversal spatial learning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4gnt A T 9: 99,620,672 N295I probably damaging Het
Abcg3 G A 5: 104,968,170 A266V probably damaging Het
Arhgap39 T C 15: 76,737,418 M328V probably benign Het
Bub1b T A 2: 118,609,844 V143D probably damaging Het
Celsr3 A G 9: 108,827,797 D493G probably damaging Het
Cers4 T A 8: 4,516,992 probably null Het
Clec4d A G 6: 123,274,770 R204G probably benign Het
Cngb1 C A 8: 95,254,195 R910L possibly damaging Het
Coro2a A T 4: 46,564,691 N18K probably benign Het
Cwf19l1 A G 19: 44,121,941 F290S probably damaging Het
Esp18 C T 17: 39,409,948 T28I probably damaging Het
Hdac10 A T 15: 89,126,945 F205Y probably benign Het
Hhip T A 8: 79,998,192 H317L possibly damaging Het
Il1f8 G A 2: 24,154,649 M20I probably benign Het
Ilf3 T A 9: 21,394,872 N276K probably damaging Het
Jchain T C 5: 88,522,517 N81S probably benign Het
Mei4 A G 9: 82,025,547 Y211C probably damaging Het
Mx2 A T 16: 97,538,704 E20V possibly damaging Het
Ndufa10 A G 1: 92,460,374 probably null Het
Nodal A G 10: 61,423,677 T298A probably damaging Het
Nvl T C 1: 181,139,298 Y47C probably damaging Het
Olfr1500 T C 19: 13,827,619 Y259C probably damaging Het
Onecut1 C T 9: 74,863,392 R366C probably damaging Het
Plekha6 G C 1: 133,272,307 R208P possibly damaging Het
Ppp5c A G 7: 17,027,691 probably null Het
Prag1 A G 8: 36,103,487 E408G probably benign Het
Ptpn21 T C 12: 98,682,550 N949S probably damaging Het
Scn7a A C 2: 66,697,568 N859K possibly damaging Het
Smarca4 T C 9: 21,686,026 I1362T probably damaging Het
Syt12 T C 19: 4,450,994 R343G possibly damaging Het
Topbp1 T C 9: 103,323,528 S587P probably benign Het
Trim80 C T 11: 115,446,475 Q388* probably null Het
Tsc2 T C 17: 24,599,887 probably null Het
Vmn2r3 T A 3: 64,259,023 T896S possibly damaging Het
Vmn2r-ps130 T A 17: 23,061,487 S41T probably benign Het
Xirp2 A G 2: 67,509,662 E749G probably damaging Het
Zbtb24 G A 10: 41,451,853 G245E probably benign Het
Zfp507 A G 7: 35,787,742 V767A probably benign Het
Other mutations in Apbb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02171:Apbb1 APN 7 105559126 splice site probably benign
athena UTSW 7 105566695 missense probably benign
R0092:Apbb1 UTSW 7 105559154 missense probably damaging 1.00
R0348:Apbb1 UTSW 7 105565303 missense probably damaging 0.98
R0633:Apbb1 UTSW 7 105558963 missense probably damaging 1.00
R0946:Apbb1 UTSW 7 105573855 missense probably benign 0.09
R1076:Apbb1 UTSW 7 105573855 missense probably benign 0.09
R1332:Apbb1 UTSW 7 105565543 missense possibly damaging 0.74
R1658:Apbb1 UTSW 7 105574084 missense probably damaging 1.00
R1739:Apbb1 UTSW 7 105574227 missense probably benign
R4230:Apbb1 UTSW 7 105567684 missense probably damaging 1.00
R4296:Apbb1 UTSW 7 105573826 missense probably benign 0.16
R4385:Apbb1 UTSW 7 105567276 missense probably benign 0.00
R4571:Apbb1 UTSW 7 105573762 missense probably damaging 1.00
R4647:Apbb1 UTSW 7 105565538 missense probably benign 0.01
R4812:Apbb1 UTSW 7 105574025 missense probably damaging 0.99
R5044:Apbb1 UTSW 7 105565682 intron probably benign
R5109:Apbb1 UTSW 7 105565035 missense probably damaging 1.00
R5479:Apbb1 UTSW 7 105565025 missense probably damaging 0.97
R5611:Apbb1 UTSW 7 105559483 missense probably damaging 1.00
R5677:Apbb1 UTSW 7 105559246 missense probably damaging 1.00
R5850:Apbb1 UTSW 7 105567583 missense probably damaging 1.00
R5896:Apbb1 UTSW 7 105574225 missense probably damaging 1.00
R6151:Apbb1 UTSW 7 105574252 nonsense probably null
R6186:Apbb1 UTSW 7 105567726 missense probably damaging 1.00
R6229:Apbb1 UTSW 7 105573730 missense probably damaging 0.98
R6229:Apbb1 UTSW 7 105573731 missense probably damaging 0.98
R6288:Apbb1 UTSW 7 105559227 missense probably damaging 1.00
R6295:Apbb1 UTSW 7 105566695 missense probably benign
R6443:Apbb1 UTSW 7 105573763 missense probably damaging 1.00
R6729:Apbb1 UTSW 7 105565381 missense probably damaging 1.00
Z1088:Apbb1 UTSW 7 105559136 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTGTTCTAGAAGACAGACCCTTC -3'
(R):5'- CACTGGTGGCTCCCAATATG -3'

Sequencing Primer
(F):5'- TTCCACCCCTGGCATGGAAC -3'
(R):5'- GCTCCCAATATGGTGACTCAAGTG -3'
Posted On2016-12-15