Incidental Mutation 'R5785:Trim80'
ID447976
Institutional Source Beutler Lab
Gene Symbol Trim80
Ensembl Gene ENSMUSG00000070332
Gene Nametripartite motif-containing 80
Synonyms4933422H20Rik
MMRRC Submission 043206-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R5785 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location115440545-115448270 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 115446475 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 388 (Q388*)
Ref Sequence ENSEMBL: ENSMUSP00000091442 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093914]
Predicted Effect probably null
Transcript: ENSMUST00000093914
AA Change: Q388*
SMART Domains Protein: ENSMUSP00000091442
Gene: ENSMUSG00000070332
AA Change: Q388*

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
RING 71 114 4.48e-7 SMART
Blast:BBOX 154 202 7e-22 BLAST
Pfam:zf-B_box 207 246 2.2e-10 PFAM
Blast:PRY 441 496 2e-18 BLAST
Pfam:SPRY 499 621 3.9e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175355
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4gnt A T 9: 99,620,672 N295I probably damaging Het
Abcg3 G A 5: 104,968,170 A266V probably damaging Het
Apbb1 C A 7: 105,567,715 D254Y probably damaging Het
Arhgap39 T C 15: 76,737,418 M328V probably benign Het
Bub1b T A 2: 118,609,844 V143D probably damaging Het
Celsr3 A G 9: 108,827,797 D493G probably damaging Het
Cers4 T A 8: 4,516,992 probably null Het
Clec4d A G 6: 123,274,770 R204G probably benign Het
Cngb1 C A 8: 95,254,195 R910L possibly damaging Het
Coro2a A T 4: 46,564,691 N18K probably benign Het
Cwf19l1 A G 19: 44,121,941 F290S probably damaging Het
Esp18 C T 17: 39,409,948 T28I probably damaging Het
Hdac10 A T 15: 89,126,945 F205Y probably benign Het
Hhip T A 8: 79,998,192 H317L possibly damaging Het
Il1f8 G A 2: 24,154,649 M20I probably benign Het
Ilf3 T A 9: 21,394,872 N276K probably damaging Het
Jchain T C 5: 88,522,517 N81S probably benign Het
Mei4 A G 9: 82,025,547 Y211C probably damaging Het
Mx2 A T 16: 97,538,704 E20V possibly damaging Het
Ndufa10 A G 1: 92,460,374 probably null Het
Nodal A G 10: 61,423,677 T298A probably damaging Het
Nvl T C 1: 181,139,298 Y47C probably damaging Het
Olfr1500 T C 19: 13,827,619 Y259C probably damaging Het
Onecut1 C T 9: 74,863,392 R366C probably damaging Het
Plekha6 G C 1: 133,272,307 R208P possibly damaging Het
Ppp5c A G 7: 17,027,691 probably null Het
Prag1 A G 8: 36,103,487 E408G probably benign Het
Ptpn21 T C 12: 98,682,550 N949S probably damaging Het
Scn7a A C 2: 66,697,568 N859K possibly damaging Het
Smarca4 T C 9: 21,686,026 I1362T probably damaging Het
Syt12 T C 19: 4,450,994 R343G possibly damaging Het
Topbp1 T C 9: 103,323,528 S587P probably benign Het
Tsc2 T C 17: 24,599,887 probably null Het
Vmn2r3 T A 3: 64,259,023 T896S possibly damaging Het
Vmn2r-ps130 T A 17: 23,061,487 S41T probably benign Het
Xirp2 A G 2: 67,509,662 E749G probably damaging Het
Zbtb24 G A 10: 41,451,853 G245E probably benign Het
Zfp507 A G 7: 35,787,742 V767A probably benign Het
Other mutations in Trim80
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00899:Trim80 APN 11 115447665 missense probably benign 0.21
IGL00921:Trim80 APN 11 115447664 missense probably benign 0.00
IGL02948:Trim80 APN 11 115441593 missense possibly damaging 0.81
IGL03037:Trim80 APN 11 115441593 missense possibly damaging 0.81
R0019:Trim80 UTSW 11 115447942 missense probably damaging 1.00
R0019:Trim80 UTSW 11 115447942 missense probably damaging 1.00
R0409:Trim80 UTSW 11 115441213 missense probably damaging 1.00
R1069:Trim80 UTSW 11 115448083 missense probably damaging 1.00
R1832:Trim80 UTSW 11 115446793 missense probably benign
R1952:Trim80 UTSW 11 115441329 nonsense probably null
R2892:Trim80 UTSW 11 115448023 missense possibly damaging 0.81
R4301:Trim80 UTSW 11 115445113 critical splice donor site probably null
R4748:Trim80 UTSW 11 115448138 missense possibly damaging 0.84
R4795:Trim80 UTSW 11 115447943 missense probably damaging 1.00
R4819:Trim80 UTSW 11 115447943 missense probably damaging 1.00
R4910:Trim80 UTSW 11 115446455 missense probably damaging 0.99
R5245:Trim80 UTSW 11 115441572 missense probably damaging 1.00
R5288:Trim80 UTSW 11 115448017 missense probably benign 0.07
R5384:Trim80 UTSW 11 115448017 missense probably benign 0.07
R5386:Trim80 UTSW 11 115448017 missense probably benign 0.07
R5508:Trim80 UTSW 11 115445078 missense probably benign 0.06
R5645:Trim80 UTSW 11 115446785 missense probably damaging 1.00
R5822:Trim80 UTSW 11 115447921 missense probably damaging 0.99
R6754:Trim80 UTSW 11 115448174 missense probably damaging 1.00
R6785:Trim80 UTSW 11 115441201 missense probably damaging 0.99
R6788:Trim80 UTSW 11 115448017 missense probably benign 0.07
R7336:Trim80 UTSW 11 115441216 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATGCTCACATCTGAAAATGGG -3'
(R):5'- TTTGCTGAGGCCACTCTTAC -3'

Sequencing Primer
(F):5'- GCTCACATCTGAAAATGGGATTTTTC -3'
(R):5'- TCCTTCCAGACAGAGGCTTG -3'
Posted On2016-12-15