Incidental Mutation 'R5786:Cacna1a'
ID448024
Institutional Source Beutler Lab
Gene Symbol Cacna1a
Ensembl Gene ENSMUSG00000034656
Gene Namecalcium channel, voltage-dependent, P/Q type, alpha 1A subunit
SynonymsCacnl1a4, alpha1A, SCA6, nmf352, Ccha1a
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.927) question?
Stock #R5786 (G1)
Quality Score201
Status Not validated
Chromosome8
Chromosomal Location84388440-84640246 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 84415721 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000121390] [ENSMUST00000122053]
Predicted Effect unknown
Transcript: ENSMUST00000121390
AA Change: V26A
SMART Domains Protein: ENSMUSP00000112436
Gene: ENSMUSG00000034656
AA Change: V26A

DomainStartEndE-ValueType
low complexity region 9 47 N/A INTRINSIC
Pfam:Ion_trans 99 373 1.5e-69 PFAM
Pfam:Ion_trans 488 727 1.2e-54 PFAM
Pfam:PKD_channel 578 721 6.6e-8 PFAM
low complexity region 920 959 N/A INTRINSIC
low complexity region 977 987 N/A INTRINSIC
low complexity region 1074 1093 N/A INTRINSIC
low complexity region 1143 1168 N/A INTRINSIC
Pfam:Ion_trans 1194 1472 4.9e-64 PFAM
Pfam:Ion_trans 1516 1773 2.8e-64 PFAM
Pfam:GPHH 1775 1844 5.6e-39 PFAM
Ca_chan_IQ 1899 1933 1.8e-12 SMART
AT_hook 2053 2065 2.02e0 SMART
low complexity region 2101 2113 N/A INTRINSIC
low complexity region 2153 2179 N/A INTRINSIC
low complexity region 2213 2236 N/A INTRINSIC
low complexity region 2253 2282 N/A INTRINSIC
low complexity region 2314 2325 N/A INTRINSIC
low complexity region 2342 2357 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000122053
AA Change: V26A
SMART Domains Protein: ENSMUSP00000114055
Gene: ENSMUSG00000034656
AA Change: V26A

DomainStartEndE-ValueType
low complexity region 9 47 N/A INTRINSIC
Pfam:Ion_trans 91 314 4.5e-58 PFAM
PDB:4DEX|B 317 427 5e-45 PDB
Pfam:Ion_trans 476 668 6.4e-46 PFAM
Pfam:PKD_channel 530 675 7.7e-8 PFAM
low complexity region 873 912 N/A INTRINSIC
low complexity region 930 940 N/A INTRINSIC
low complexity region 1027 1046 N/A INTRINSIC
low complexity region 1096 1121 N/A INTRINSIC
Pfam:Ion_trans 1183 1414 2.8e-54 PFAM
Pfam:Ion_trans 1504 1714 3.2e-60 PFAM
Ca_chan_IQ 1852 1886 1.8e-12 SMART
AT_hook 2006 2018 2.02e0 SMART
low complexity region 2054 2066 N/A INTRINSIC
low complexity region 2106 2132 N/A INTRINSIC
low complexity region 2166 2189 N/A INTRINSIC
low complexity region 2206 2235 N/A INTRINSIC
low complexity region 2267 2278 N/A INTRINSIC
low complexity region 2295 2310 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135382
Predicted Effect probably benign
Transcript: ENSMUST00000215756
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-dependent calcium channels mediate the entry of calcium ions into excitable cells, and are also involved in a variety of calcium-dependent processes, including muscle contraction, hormone or neurotransmitter release, and gene expression. Calcium channels are multisubunit complexes composed of alpha-1, beta, alpha-2/delta, and gamma subunits. The channel activity is directed by the pore-forming alpha-1 subunit, whereas, the others act as auxiliary subunits regulating this activity. The distinctive properties of the calcium channel types are related primarily to the expression of a variety of alpha-1 isoforms, alpha-1A, B, C, D, E, and S. This gene encodes the alpha-1A subunit, which is predominantly expressed in neuronal tissue. Mutations in this gene are associated with 2 neurologic disorders, familial hemiplegic migraine and episodic ataxia 2. This gene also exhibits polymorphic variation due to (CAG)n-repeats. Multiple transcript variants encoding different isoforms have been found for this gene. In one set of transcript variants, the (CAG)n-repeats occur in the 3' UTR, and are not associated with any disease. But in another set of variants, an insertion extends the coding region to include the (CAG)n-repeats which encode a polyglutamine tract. Expansion of the (CAG)n-repeats from the normal 4-18 to 21-33 in the coding region is associated with spinocerebellar ataxia 6. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygotes for different mutant alleles are characterized by variably severe wobbly gait beginning prior to weaning, ataxia, episodic dyskinesia, cerebellar atrophy, and absence epilepsy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810009J06Rik T A 6: 40,968,188 D200E probably damaging Het
4930578I06Rik C A 14: 63,973,242 R179L probably damaging Het
Abhd5 A G 9: 122,363,803 probably null Het
Ankrd60 TGGCCACGCGG TGG 2: 173,578,089 probably null Het
Ano5 G A 7: 51,566,318 D348N possibly damaging Het
Apob C T 12: 8,015,304 T4091I possibly damaging Het
Avil G A 10: 127,016,499 probably null Het
C530008M17Rik T C 5: 76,866,196 probably null Het
Capn7 T C 14: 31,360,145 L436P probably damaging Het
Ccdc33 A G 9: 58,029,952 S655P possibly damaging Het
Ccr6 T C 17: 8,256,412 S150P probably damaging Het
Cd1d1 T C 3: 86,998,788 N60S probably benign Het
Ckap5 A G 2: 91,616,296 probably null Het
Col15a1 A G 4: 47,280,865 E753G possibly damaging Het
Col1a2 C T 6: 4,530,223 R699W unknown Het
Csf2rb T C 15: 78,348,955 Y821H probably damaging Het
Cyp3a11 A G 5: 145,862,474 I301T possibly damaging Het
Dpp3 C T 19: 4,918,322 G241R possibly damaging Het
Dpyd G T 3: 119,427,237 M952I probably damaging Het
Dsg3 A T 18: 20,521,571 I111L possibly damaging Het
Ect2 A G 3: 27,146,953 F123L probably damaging Het
Ehmt2 G C 17: 34,910,743 D961H probably damaging Het
Esp1 A G 17: 40,730,918 I34V probably benign Het
Fam171b G A 2: 83,878,236 V361I probably benign Het
Flnc T A 6: 29,459,537 Y2545* probably null Het
Fmo4 C T 1: 162,803,717 G227D probably benign Het
Grn C T 11: 102,434,043 Q153* probably null Het
H2-DMb1 T G 17: 34,153,434 S12R possibly damaging Het
Ica1 G T 6: 8,672,391 N203K possibly damaging Het
Kdm4c C A 4: 74,359,485 T792K probably damaging Het
Kif19a T A 11: 114,779,223 Y81* probably null Het
Kifc2 G T 15: 76,664,378 C440F probably damaging Het
Lpin2 A G 17: 71,230,273 T234A probably benign Het
Lysmd2 C A 9: 75,635,603 P164Q probably benign Het
Maea T A 5: 33,368,683 D234E probably benign Het
Map4k1 T A 7: 29,000,020 V572E probably damaging Het
Med6 C T 12: 81,573,959 G166R probably null Het
Mtmr10 T C 7: 64,337,710 I666T probably damaging Het
Myh14 T A 7: 44,613,463 K1777M probably benign Het
Naip6 G T 13: 100,300,216 Q600K probably benign Het
Obscn A G 11: 59,032,691 S6461P probably damaging Het
Olfr350 T C 2: 36,850,049 M1T probably null Het
Osbpl7 T A 11: 97,065,832 V567E probably damaging Het
Rad51ap2 A T 12: 11,456,920 D281V probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rpl24 C A 16: 55,967,153 H59N possibly damaging Het
Rtl1 G A 12: 109,592,619 L929F possibly damaging Het
Runx3 C T 4: 135,163,264 T159I probably damaging Het
Serpine2 T C 1: 79,816,920 I99V probably benign Het
Slc12a6 C A 2: 112,284,722 P12Q probably benign Het
Slc25a18 T C 6: 120,792,074 L184P probably damaging Het
Smg1 T C 7: 118,212,897 D57G probably benign Het
Spdye4c T A 2: 128,596,841 *340K probably null Het
Srsf5 G A 12: 80,949,537 E162K possibly damaging Het
Ssc5d T C 7: 4,936,818 V751A probably benign Het
Tcf3 T C 10: 80,419,499 N157S probably benign Het
Tdrd7 T C 4: 45,989,082 V71A probably benign Het
Tex14 T C 11: 87,514,295 C678R probably damaging Het
Tgm3 A T 2: 130,026,784 K214* probably null Het
Vps53 A G 11: 76,063,007 I659T probably benign Het
Zfp597 A T 16: 3,866,159 C244* probably null Het
Zfp933 T A 4: 147,828,407 probably null Het
Other mutations in Cacna1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00507:Cacna1a APN 8 84571208 nonsense probably null
IGL00513:Cacna1a APN 8 84553056 missense probably damaging 1.00
IGL00569:Cacna1a APN 8 84462714 missense probably damaging 1.00
IGL00981:Cacna1a APN 8 84548553 missense probably damaging 1.00
IGL01122:Cacna1a APN 8 84614793 critical splice donor site probably null
IGL01309:Cacna1a APN 8 84523028 missense probably damaging 1.00
IGL01380:Cacna1a APN 8 84559117 missense probably damaging 1.00
IGL01638:Cacna1a APN 8 84571827 missense probably damaging 0.98
IGL01682:Cacna1a APN 8 84536438 missense possibly damaging 0.71
IGL02751:Cacna1a APN 8 84569952 missense probably damaging 1.00
IGL02904:Cacna1a APN 8 84579520 missense probably damaging 1.00
IGL03122:Cacna1a APN 8 84462676 splice site probably benign
totter UTSW 8 84588753 missense probably damaging 0.99
totter2 UTSW 8 84588753 missense probably damaging 0.99
FR4340:Cacna1a UTSW 8 84638723 small insertion probably benign
FR4449:Cacna1a UTSW 8 84638714 small insertion probably benign
FR4449:Cacna1a UTSW 8 84638720 small insertion probably benign
FR4449:Cacna1a UTSW 8 84638723 small insertion probably benign
FR4548:Cacna1a UTSW 8 84638717 small insertion probably benign
FR4737:Cacna1a UTSW 8 84638720 small insertion probably benign
FR4737:Cacna1a UTSW 8 84638726 small insertion probably benign
FR4976:Cacna1a UTSW 8 84638717 small insertion probably benign
FR4976:Cacna1a UTSW 8 84638726 small insertion probably benign
IGL03134:Cacna1a UTSW 8 84559087 missense probably damaging 1.00
R0055:Cacna1a UTSW 8 84580058 splice site probably benign
R0118:Cacna1a UTSW 8 84536083 missense probably damaging 1.00
R0284:Cacna1a UTSW 8 84612285 missense probably damaging 1.00
R0581:Cacna1a UTSW 8 84601936 missense possibly damaging 0.83
R0607:Cacna1a UTSW 8 84629831 missense probably damaging 1.00
R1168:Cacna1a UTSW 8 84579501 missense probably damaging 1.00
R1183:Cacna1a UTSW 8 84580217 missense probably damaging 1.00
R1470:Cacna1a UTSW 8 84514950 splice site probably benign
R1503:Cacna1a UTSW 8 84601946 missense probably benign 0.23
R1522:Cacna1a UTSW 8 84633433 missense probably benign 0.00
R1835:Cacna1a UTSW 8 84581357 splice site probably null
R1862:Cacna1a UTSW 8 84415930 missense possibly damaging 0.80
R2148:Cacna1a UTSW 8 84629675 missense possibly damaging 0.71
R2237:Cacna1a UTSW 8 84633765 critical splice donor site probably null
R2567:Cacna1a UTSW 8 84549725 missense probably damaging 1.00
R2999:Cacna1a UTSW 8 84567742 missense probably damaging 1.00
R3025:Cacna1a UTSW 8 84580225 critical splice donor site probably null
R3610:Cacna1a UTSW 8 84559065 missense probably damaging 1.00
R3702:Cacna1a UTSW 8 84617846 missense probably damaging 0.98
R3763:Cacna1a UTSW 8 84583642 missense possibly damaging 0.85
R4025:Cacna1a UTSW 8 84581333 missense probably damaging 1.00
R4026:Cacna1a UTSW 8 84581333 missense probably damaging 1.00
R4106:Cacna1a UTSW 8 84583695 missense possibly damaging 0.85
R4296:Cacna1a UTSW 8 84559293 missense probably damaging 1.00
R4664:Cacna1a UTSW 8 84601767 nonsense probably null
R4713:Cacna1a UTSW 8 84549514 missense probably damaging 1.00
R5223:Cacna1a UTSW 8 84587195 missense possibly damaging 0.94
R5408:Cacna1a UTSW 8 84549707 missense probably damaging 1.00
R5644:Cacna1a UTSW 8 84462777 missense probably damaging 1.00
R5734:Cacna1a UTSW 8 84583731 missense probably damaging 0.96
R5833:Cacna1a UTSW 8 84518697 missense probably damaging 1.00
R5886:Cacna1a UTSW 8 84523022 missense probably damaging 0.99
R6049:Cacna1a UTSW 8 84638846 missense probably damaging 0.96
R6054:Cacna1a UTSW 8 84556785 missense probably damaging 0.99
R6117:Cacna1a UTSW 8 84614721 missense probably damaging 1.00
R6149:Cacna1a UTSW 8 84569952 missense probably damaging 1.00
R6195:Cacna1a UTSW 8 84588753 missense probably damaging 0.99
R6233:Cacna1a UTSW 8 84588753 missense probably damaging 0.99
R6607:Cacna1a UTSW 8 84579492 missense probably damaging 1.00
R6753:Cacna1a UTSW 8 84580205 missense probably damaging 1.00
R6798:Cacna1a UTSW 8 84611602 missense probably damaging 1.00
R6831:Cacna1a UTSW 8 84571231 missense probably damaging 1.00
R6980:Cacna1a UTSW 8 84612285 missense possibly damaging 0.85
R7051:Cacna1a UTSW 8 84629915 missense possibly damaging 0.85
R7270:Cacna1a UTSW 8 84571237 missense probably damaging 1.00
X0022:Cacna1a UTSW 8 84633699 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- TAGACTTCGCGTTTTAAAGGGG -3'
(R):5'- TCTTCACTGAAGAGGAACAGGG -3'

Sequencing Primer
(F):5'- GATCGCGTCCCCGGTTATTTTTG -3'
(R):5'- ACAGGGAGCGGTTGACC -3'
Posted On2016-12-15