Incidental Mutation 'R5786:Rpl24'
ID 448050
Institutional Source Beutler Lab
Gene Symbol Rpl24
Ensembl Gene ENSMUSG00000098274
Gene Name ribosomal protein L24
Synonyms Bst, 0610008L05Rik
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5786 (G1)
Quality Score 225
Status Not validated
Chromosome 16
Chromosomal Location 55786638-55791798 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 55787516 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Asparagine at position 59 (H59N)
Ref Sequence ENSEMBL: ENSMUSP00000023269 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023269]
AlphaFold Q8BP67
Predicted Effect possibly damaging
Transcript: ENSMUST00000023269
AA Change: H59N

PolyPhen 2 Score 0.513 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000023269
Gene: ENSMUSG00000098274
AA Change: H59N

DomainStartEndE-ValueType
TRASH 6 44 9.53e-6 SMART
low complexity region 102 142 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122365
SMART Domains Protein: ENSMUSP00000114135
Gene: ENSMUSG00000022601

DomainStartEndE-ValueType
TRASH 6 44 9.53e-6 SMART
coiled coil region 102 126 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126419
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128581
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137811
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L24E family of ribosomal proteins. It is located in the cytoplasm. This gene has been referred to as ribosomal protein L30 because the encoded protein shares amino acid identity with the L30 ribosomal proteins from S. cerevisiae; however, its official name is ribosomal protein L24. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Heterozygous mutants have short kinked tail, ventral spotting, malocclusion, white feet, and anomalies of the spine and eyes; homozygotes die in utero. [provided by MGI curators]
Allele List at MGI

All alleles(12) : Targeted(1) Gene trapped(10) Spontaneous(1)
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810009J06Rik T A 6: 40,945,122 (GRCm39) D200E probably damaging Het
4930578I06Rik C A 14: 64,210,691 (GRCm39) R179L probably damaging Het
Abhd5 A G 9: 122,192,868 (GRCm39) probably null Het
Ankrd60 TGGCCACGCGG TGG 2: 173,419,882 (GRCm39) probably null Het
Ano5 G A 7: 51,216,066 (GRCm39) D348N possibly damaging Het
Apob C T 12: 8,065,304 (GRCm39) T4091I possibly damaging Het
Avil G A 10: 126,852,368 (GRCm39) probably null Het
Cacna1a T C 8: 85,142,350 (GRCm39) probably benign Het
Capn7 T C 14: 31,082,102 (GRCm39) L436P probably damaging Het
Ccdc33 A G 9: 57,937,235 (GRCm39) S655P possibly damaging Het
Ccr6 T C 17: 8,475,244 (GRCm39) S150P probably damaging Het
Cd1d1 T C 3: 86,906,095 (GRCm39) N60S probably benign Het
Ckap5 A G 2: 91,446,641 (GRCm39) probably null Het
Col15a1 A G 4: 47,280,865 (GRCm39) E753G possibly damaging Het
Col1a2 C T 6: 4,530,223 (GRCm39) R699W unknown Het
Cracd T C 5: 77,014,043 (GRCm39) probably null Het
Csf2rb T C 15: 78,233,155 (GRCm39) Y821H probably damaging Het
Cyp3a11 A G 5: 145,799,284 (GRCm39) I301T possibly damaging Het
Dpp3 C T 19: 4,968,350 (GRCm39) G241R possibly damaging Het
Dpyd G T 3: 119,220,886 (GRCm39) M952I probably damaging Het
Dsg3 A T 18: 20,654,628 (GRCm39) I111L possibly damaging Het
Ect2 A G 3: 27,201,102 (GRCm39) F123L probably damaging Het
Ehmt2 G C 17: 35,129,719 (GRCm39) D961H probably damaging Het
Esp1 A G 17: 41,041,809 (GRCm39) I34V probably benign Het
Fam171b G A 2: 83,708,580 (GRCm39) V361I probably benign Het
Flnc T A 6: 29,459,536 (GRCm39) Y2545* probably null Het
Fmo4 C T 1: 162,631,286 (GRCm39) G227D probably benign Het
Grn C T 11: 102,324,869 (GRCm39) Q153* probably null Het
H2-DMb1 T G 17: 34,372,408 (GRCm39) S12R possibly damaging Het
Ica1 G T 6: 8,672,391 (GRCm39) N203K possibly damaging Het
Kdm4c C A 4: 74,277,722 (GRCm39) T792K probably damaging Het
Kif19a T A 11: 114,670,049 (GRCm39) Y81* probably null Het
Kifc2 G T 15: 76,548,578 (GRCm39) C440F probably damaging Het
Lpin2 A G 17: 71,537,268 (GRCm39) T234A probably benign Het
Lysmd2 C A 9: 75,542,885 (GRCm39) P164Q probably benign Het
Maea T A 5: 33,526,027 (GRCm39) D234E probably benign Het
Map4k1 T A 7: 28,699,445 (GRCm39) V572E probably damaging Het
Med6 C T 12: 81,620,733 (GRCm39) G166R probably null Het
Mtmr10 T C 7: 63,987,458 (GRCm39) I666T probably damaging Het
Myh14 T A 7: 44,262,887 (GRCm39) K1777M probably benign Het
Naip6 G T 13: 100,436,724 (GRCm39) Q600K probably benign Het
Obscn A G 11: 58,923,517 (GRCm39) S6461P probably damaging Het
Or1j4 T C 2: 36,740,061 (GRCm39) M1T probably null Het
Osbpl7 T A 11: 96,956,658 (GRCm39) V567E probably damaging Het
Rad51ap2 A T 12: 11,506,921 (GRCm39) D281V probably damaging Het
Rnd2 C T 11: 101,359,825 (GRCm39) L57F probably damaging Het
Rtl1 G A 12: 109,559,053 (GRCm39) L929F possibly damaging Het
Runx3 C T 4: 134,890,575 (GRCm39) T159I probably damaging Het
Serpine2 T C 1: 79,794,637 (GRCm39) I99V probably benign Het
Slc12a6 C A 2: 112,115,067 (GRCm39) P12Q probably benign Het
Slc25a18 T C 6: 120,769,035 (GRCm39) L184P probably damaging Het
Smg1 T C 7: 117,812,120 (GRCm39) D57G probably benign Het
Spdye4c T A 2: 128,438,761 (GRCm39) *340K probably null Het
Srsf5 G A 12: 80,996,311 (GRCm39) E162K possibly damaging Het
Ssc5d T C 7: 4,939,817 (GRCm39) V751A probably benign Het
Tcf3 T C 10: 80,255,333 (GRCm39) N157S probably benign Het
Tdrd7 T C 4: 45,989,082 (GRCm39) V71A probably benign Het
Tex14 T C 11: 87,405,121 (GRCm39) C678R probably damaging Het
Tgm3 A T 2: 129,868,704 (GRCm39) K214* probably null Het
Vps53 A G 11: 75,953,833 (GRCm39) I659T probably benign Het
Zfp597 A T 16: 3,684,023 (GRCm39) C244* probably null Het
Zfp933 T A 4: 147,912,864 (GRCm39) probably null Het
Other mutations in Rpl24
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0347:Rpl24 UTSW 16 55,790,540 (GRCm39) critical splice donor site probably null
R4110:Rpl24 UTSW 16 55,791,723 (GRCm39) missense probably benign 0.00
R7252:Rpl24 UTSW 16 55,790,479 (GRCm39) missense possibly damaging 0.74
R8348:Rpl24 UTSW 16 55,787,453 (GRCm39) missense probably damaging 0.99
R8448:Rpl24 UTSW 16 55,787,453 (GRCm39) missense probably damaging 0.99
R9562:Rpl24 UTSW 16 55,790,509 (GRCm39) missense probably benign
R9565:Rpl24 UTSW 16 55,790,509 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- GATGCCACCCTGTCATTTGTG -3'
(R):5'- TATGGTACCCAAGGCCACAC -3'

Sequencing Primer
(F):5'- GAGAAGAGAGAAGTAGAATAAAGCTG -3'
(R):5'- CTAACAAGTTCTGCTACTGTCTGATG -3'
Posted On 2016-12-15