Incidental Mutation 'R5786:Ehmt2'
ID448053
Institutional Source Beutler Lab
Gene Symbol Ehmt2
Ensembl Gene ENSMUSG00000013787
Gene Nameeuchromatic histone lysine N-methyltransferase 2
SynonymsNG36, D17Ertd710e, G9a, KMT1C, Bat8
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5786 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location34898469-34914052 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 34910743 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Histidine at position 961 (D961H)
Ref Sequence ENSEMBL: ENSMUSP00000094955 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007249] [ENSMUST00000013931] [ENSMUST00000078061] [ENSMUST00000097342] [ENSMUST00000114033] [ENSMUST00000124846] [ENSMUST00000137071]
Predicted Effect probably benign
Transcript: ENSMUST00000007249
SMART Domains Protein: ENSMUSP00000007249
Gene: ENSMUSG00000007034

DomainStartEndE-ValueType
transmembrane domain 34 56 N/A INTRINSIC
low complexity region 93 102 N/A INTRINSIC
transmembrane domain 226 248 N/A INTRINSIC
transmembrane domain 250 272 N/A INTRINSIC
Pfam:Choline_transpo 311 674 5.4e-119 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000013931
AA Change: D995H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000013931
Gene: ENSMUSG00000013787
AA Change: D995H

DomainStartEndE-ValueType
low complexity region 2 47 N/A INTRINSIC
coiled coil region 336 385 N/A INTRINSIC
low complexity region 407 424 N/A INTRINSIC
low complexity region 604 627 N/A INTRINSIC
ANK 737 766 2.52e-6 SMART
ANK 770 799 1.19e-2 SMART
ANK 803 833 4.71e-6 SMART
ANK 837 866 2.9e-6 SMART
ANK 870 899 1e0 SMART
ANK 903 932 1.53e-5 SMART
PreSET 976 1075 2.44e-40 SMART
SET 1091 1214 4.08e-46 SMART
PostSET 1217 1233 2.84e-1 SMART
low complexity region 1245 1260 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000078061
AA Change: D904H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077208
Gene: ENSMUSG00000013787
AA Change: D904H

DomainStartEndE-ValueType
low complexity region 2 23 N/A INTRINSIC
coiled coil region 279 328 N/A INTRINSIC
low complexity region 350 367 N/A INTRINSIC
low complexity region 513 536 N/A INTRINSIC
ANK 646 675 2.52e-6 SMART
ANK 679 708 1.19e-2 SMART
ANK 712 742 4.71e-6 SMART
ANK 746 775 2.9e-6 SMART
ANK 779 808 1e0 SMART
ANK 812 841 1.53e-5 SMART
PreSET 885 984 2.44e-40 SMART
SET 1000 1123 4.08e-46 SMART
PostSET 1126 1142 2.84e-1 SMART
low complexity region 1154 1169 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000097342
AA Change: D961H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000094955
Gene: ENSMUSG00000013787
AA Change: D961H

DomainStartEndE-ValueType
low complexity region 2 47 N/A INTRINSIC
coiled coil region 336 385 N/A INTRINSIC
low complexity region 407 424 N/A INTRINSIC
low complexity region 570 593 N/A INTRINSIC
ANK 703 732 2.52e-6 SMART
ANK 736 765 1.19e-2 SMART
ANK 769 799 4.71e-6 SMART
ANK 803 832 2.9e-6 SMART
ANK 836 865 1e0 SMART
ANK 869 898 1.53e-5 SMART
PreSET 942 1041 2.44e-40 SMART
SET 1057 1180 4.08e-46 SMART
PostSET 1183 1199 2.84e-1 SMART
low complexity region 1211 1226 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114033
AA Change: D938H

PolyPhen 2 Score 0.822 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000109667
Gene: ENSMUSG00000013787
AA Change: D938H

DomainStartEndE-ValueType
low complexity region 2 23 N/A INTRINSIC
coiled coil region 279 328 N/A INTRINSIC
low complexity region 350 367 N/A INTRINSIC
low complexity region 547 570 N/A INTRINSIC
ANK 680 709 2.52e-6 SMART
ANK 713 742 1.19e-2 SMART
ANK 746 776 4.71e-6 SMART
ANK 780 809 2.9e-6 SMART
ANK 813 842 1e0 SMART
ANK 846 875 1.53e-5 SMART
PreSET 919 1018 2.44e-40 SMART
SET 1034 1157 4.08e-46 SMART
PostSET 1160 1176 2.84e-1 SMART
low complexity region 1188 1203 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124002
Predicted Effect probably benign
Transcript: ENSMUST00000124846
SMART Domains Protein: ENSMUSP00000121838
Gene: ENSMUSG00000013787

DomainStartEndE-ValueType
low complexity region 115 138 N/A INTRINSIC
low complexity region 204 215 N/A INTRINSIC
ANK 258 287 2.52e-6 SMART
ANK 291 320 1.19e-2 SMART
ANK 324 354 4.71e-6 SMART
ANK 358 387 2.9e-6 SMART
ANK 391 420 1e0 SMART
Pfam:Ank 424 442 3.4e-4 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131915
Predicted Effect probably benign
Transcript: ENSMUST00000137071
SMART Domains Protein: ENSMUSP00000134749
Gene: ENSMUSG00000013787

DomainStartEndE-ValueType
ANK 23 52 1.19e-2 SMART
ANK 56 86 4.71e-6 SMART
ANK 90 119 2.9e-6 SMART
low complexity region 143 154 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138500
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145201
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145624
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150786
Predicted Effect probably benign
Transcript: ENSMUST00000172921
SMART Domains Protein: ENSMUSP00000134089
Gene: ENSMUSG00000013787

DomainStartEndE-ValueType
ANK 24 53 1.19e-2 SMART
ANK 57 87 4.71e-6 SMART
ANK 89 118 1e0 SMART
ANK 122 151 1.53e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173664
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a methyltransferase that methylates lysine residues of histone H3. Methylation of H3 at lysine 9 by this protein results in recruitment of additional epigenetic regulators and repression of transcription. This gene was initially thought to be two different genes, NG36 and G9a, adjacent to each other in the HLA locus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality around E9.5-E12.5. Mutant embryos are developmentally delayed. Conditional deletion in germ cells results in infertility and arrest of meiosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810009J06Rik T A 6: 40,968,188 D200E probably damaging Het
4930578I06Rik C A 14: 63,973,242 R179L probably damaging Het
Abhd5 A G 9: 122,363,803 probably null Het
Ankrd60 TGGCCACGCGG TGG 2: 173,578,089 probably null Het
Ano5 G A 7: 51,566,318 D348N possibly damaging Het
Apob C T 12: 8,015,304 T4091I possibly damaging Het
Avil G A 10: 127,016,499 probably null Het
C530008M17Rik T C 5: 76,866,196 probably null Het
Cacna1a T C 8: 84,415,721 probably benign Het
Capn7 T C 14: 31,360,145 L436P probably damaging Het
Ccdc33 A G 9: 58,029,952 S655P possibly damaging Het
Ccr6 T C 17: 8,256,412 S150P probably damaging Het
Cd1d1 T C 3: 86,998,788 N60S probably benign Het
Ckap5 A G 2: 91,616,296 probably null Het
Col15a1 A G 4: 47,280,865 E753G possibly damaging Het
Col1a2 C T 6: 4,530,223 R699W unknown Het
Csf2rb T C 15: 78,348,955 Y821H probably damaging Het
Cyp3a11 A G 5: 145,862,474 I301T possibly damaging Het
Dpp3 C T 19: 4,918,322 G241R possibly damaging Het
Dpyd G T 3: 119,427,237 M952I probably damaging Het
Dsg3 A T 18: 20,521,571 I111L possibly damaging Het
Ect2 A G 3: 27,146,953 F123L probably damaging Het
Esp1 A G 17: 40,730,918 I34V probably benign Het
Fam171b G A 2: 83,878,236 V361I probably benign Het
Flnc T A 6: 29,459,537 Y2545* probably null Het
Fmo4 C T 1: 162,803,717 G227D probably benign Het
Grn C T 11: 102,434,043 Q153* probably null Het
H2-DMb1 T G 17: 34,153,434 S12R possibly damaging Het
Ica1 G T 6: 8,672,391 N203K possibly damaging Het
Kdm4c C A 4: 74,359,485 T792K probably damaging Het
Kif19a T A 11: 114,779,223 Y81* probably null Het
Kifc2 G T 15: 76,664,378 C440F probably damaging Het
Lpin2 A G 17: 71,230,273 T234A probably benign Het
Lysmd2 C A 9: 75,635,603 P164Q probably benign Het
Maea T A 5: 33,368,683 D234E probably benign Het
Map4k1 T A 7: 29,000,020 V572E probably damaging Het
Med6 C T 12: 81,573,959 G166R probably null Het
Mtmr10 T C 7: 64,337,710 I666T probably damaging Het
Myh14 T A 7: 44,613,463 K1777M probably benign Het
Naip6 G T 13: 100,300,216 Q600K probably benign Het
Obscn A G 11: 59,032,691 S6461P probably damaging Het
Olfr350 T C 2: 36,850,049 M1T probably null Het
Osbpl7 T A 11: 97,065,832 V567E probably damaging Het
Rad51ap2 A T 12: 11,456,920 D281V probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rpl24 C A 16: 55,967,153 H59N possibly damaging Het
Rtl1 G A 12: 109,592,619 L929F possibly damaging Het
Runx3 C T 4: 135,163,264 T159I probably damaging Het
Serpine2 T C 1: 79,816,920 I99V probably benign Het
Slc12a6 C A 2: 112,284,722 P12Q probably benign Het
Slc25a18 T C 6: 120,792,074 L184P probably damaging Het
Smg1 T C 7: 118,212,897 D57G probably benign Het
Spdye4c T A 2: 128,596,841 *340K probably null Het
Srsf5 G A 12: 80,949,537 E162K possibly damaging Het
Ssc5d T C 7: 4,936,818 V751A probably benign Het
Tcf3 T C 10: 80,419,499 N157S probably benign Het
Tdrd7 T C 4: 45,989,082 V71A probably benign Het
Tex14 T C 11: 87,514,295 C678R probably damaging Het
Tgm3 A T 2: 130,026,784 K214* probably null Het
Vps53 A G 11: 76,063,007 I659T probably benign Het
Zfp597 A T 16: 3,866,159 C244* probably null Het
Zfp933 T A 4: 147,828,407 probably null Het
Other mutations in Ehmt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00973:Ehmt2 APN 17 34910815 missense probably damaging 1.00
IGL02398:Ehmt2 APN 17 34908479 missense probably damaging 1.00
IGL02878:Ehmt2 APN 17 34910767 missense probably damaging 1.00
IGL02928:Ehmt2 APN 17 34910822 missense probably damaging 1.00
IGL03117:Ehmt2 APN 17 34906811 missense possibly damaging 0.54
R0630:Ehmt2 UTSW 17 34899842 missense probably benign 0.02
R0778:Ehmt2 UTSW 17 34905418 missense probably damaging 0.99
R0909:Ehmt2 UTSW 17 34906504 missense possibly damaging 0.95
R1402:Ehmt2 UTSW 17 34906781 missense probably benign 0.21
R1402:Ehmt2 UTSW 17 34906781 missense probably benign 0.21
R1405:Ehmt2 UTSW 17 34906577 missense probably benign
R1405:Ehmt2 UTSW 17 34906577 missense probably benign
R1693:Ehmt2 UTSW 17 34906410 missense possibly damaging 0.88
R1855:Ehmt2 UTSW 17 34910776 missense probably damaging 1.00
R2212:Ehmt2 UTSW 17 34899365 missense probably benign
R2275:Ehmt2 UTSW 17 34910715 missense possibly damaging 0.95
R3761:Ehmt2 UTSW 17 34913731 missense probably damaging 0.97
R3827:Ehmt2 UTSW 17 34906765 missense possibly damaging 0.95
R3915:Ehmt2 UTSW 17 34903467 missense probably damaging 0.99
R4303:Ehmt2 UTSW 17 34908748 missense possibly damaging 0.92
R4529:Ehmt2 UTSW 17 34913731 missense probably damaging 0.97
R4651:Ehmt2 UTSW 17 34913814 missense probably damaging 1.00
R4825:Ehmt2 UTSW 17 34906964 missense probably benign
R5061:Ehmt2 UTSW 17 34899091 nonsense probably null
R5158:Ehmt2 UTSW 17 34911664 missense probably damaging 1.00
R5298:Ehmt2 UTSW 17 34899091 nonsense probably null
R5299:Ehmt2 UTSW 17 34899091 nonsense probably null
R5523:Ehmt2 UTSW 17 34899091 nonsense probably null
R5524:Ehmt2 UTSW 17 34899091 nonsense probably null
R5727:Ehmt2 UTSW 17 34906032 missense possibly damaging 0.75
R5755:Ehmt2 UTSW 17 34908238 missense probably benign 0.05
R5951:Ehmt2 UTSW 17 34899381 missense probably benign
R6036:Ehmt2 UTSW 17 34899091 nonsense probably null
R6162:Ehmt2 UTSW 17 34899091 nonsense probably null
R6708:Ehmt2 UTSW 17 34899899 nonsense probably null
R6889:Ehmt2 UTSW 17 34912772 missense probably damaging 1.00
R6943:Ehmt2 UTSW 17 34911430 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTAGCCGAGATTGTTCTCCGTG -3'
(R):5'- TTCCAGGACAGTGAGTGGTG -3'

Sequencing Primer
(F):5'- CGAGATTGTTCTCCGTGGTGTC -3'
(R):5'- ACAGTGAGTGGTGGTGGTCC -3'
Posted On2016-12-15