Incidental Mutation 'R5787:Tbck'
ID448066
Institutional Source Beutler Lab
Gene Symbol Tbck
Ensembl Gene ENSMUSG00000028030
Gene NameTBC1 domain containing kinase
SynonymsA630047E20Rik, C030007I09Rik, 1700120J03Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.262) question?
Stock #R5787 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location132684144-132841688 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 132737568 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 585 (D585V)
Ref Sequence ENSEMBL: ENSMUSP00000129205 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169172]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000029664
SMART Domains Protein: ENSMUSP00000029664
Gene: ENSMUSG00000028030

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 32 270 6.2e-30 PFAM
Pfam:Pkinase 33 273 1.9e-39 PFAM
Pfam:Kinase-like 71 261 3.4e-8 PFAM
Blast:TBC 366 450 5e-34 BLAST
TBC 463 674 5.27e-46 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000169172
AA Change: D585V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129205
Gene: ENSMUSG00000028030
AA Change: D585V

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 32 270 4.5e-29 PFAM
Pfam:Pkinase 32 273 1.4e-39 PFAM
Blast:TBC 366 450 5e-34 BLAST
TBC 463 674 5.27e-46 SMART
RHOD 780 886 2.67e-13 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains a protein kinase domain, a Rhodanase-like domain and the Tre-2/Bub2/Cdc16 (TBC) domain. The encoded protein is thought to play a role in actin organization, cell growth and cell proliferation by regulating the mammalian target of the rapamycin (mTOR) signaling pathway. This protein may also be involved in the transcriptional regulation of the components of the mTOR complex. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 36,992,733 probably null Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Adam24 A G 8: 40,680,902 N470D possibly damaging Het
Adcy8 T C 15: 64,704,218 D1027G probably damaging Het
Amph A T 13: 18,948,454 I8F possibly damaging Het
Ankrd60 TGGCCACGCGG TGG 2: 173,578,089 probably null Het
Ano5 G A 7: 51,566,318 D348N possibly damaging Het
Atp6v0a1 A G 11: 101,018,574 D43G probably benign Het
Btnl10 T A 11: 58,920,343 I164N probably damaging Het
Ccdc174 C T 6: 91,881,310 Q71* probably null Het
Ceacam3 G A 7: 17,155,046 E247K possibly damaging Het
Chrna2 A G 14: 66,149,008 D201G probably benign Het
Clasp2 G A 9: 113,862,242 D448N probably damaging Het
Clcn2 C A 16: 20,703,433 R829L probably damaging Het
Clock A G 5: 76,237,051 S440P probably damaging Het
Cntn2 T C 1: 132,523,059 D29G probably damaging Het
Cpne4 A G 9: 105,022,401 T428A probably benign Het
Cul3 T C 1: 80,282,721 I304V probably benign Het
Cyp11a1 C A 9: 58,015,267 Q77K probably benign Het
Cyp3a25 A G 5: 145,998,503 V101A probably benign Het
Cyp4f15 T C 17: 32,702,808 F485L probably damaging Het
Des T A 1: 75,363,646 V399E probably damaging Het
Dhx58 T C 11: 100,701,319 D301G possibly damaging Het
Ear6 A G 14: 51,854,398 E134G probably benign Het
Eif2b3 A G 4: 117,044,440 D100G probably damaging Het
Erich1 T C 8: 14,033,776 probably null Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Htr4 T C 18: 62,413,622 V82A probably damaging Het
Hydin A G 8: 110,326,353 D219G probably damaging Het
Ifit1 T A 19: 34,647,575 V37E probably benign Het
Isg20 T A 7: 78,919,810 D176E probably benign Het
Islr2 A G 9: 58,198,354 V585A probably damaging Het
Kat6a A G 8: 22,932,647 E991G probably damaging Het
Kcnv1 T C 15: 45,114,330 Y104C probably damaging Het
Lrtm1 G C 14: 29,021,990 E138D possibly damaging Het
Mllt3 A T 4: 87,840,820 D330E probably damaging Het
Mpp7 T C 18: 7,461,682 N64D probably benign Het
Naip6 G T 13: 100,300,216 Q600K probably benign Het
Nop9 T G 14: 55,746,334 C141G possibly damaging Het
Nos1ap T C 1: 170,318,572 E471G probably benign Het
Npr2 A G 4: 43,633,593 T246A possibly damaging Het
Olfr1249 T A 2: 89,630,674 I75F probably benign Het
Olfr1348 A T 7: 6,501,990 S79T probably damaging Het
Olfr31 A C 14: 14,328,725 M205L probably damaging Het
Pdlim4 T A 11: 54,055,216 D271V probably damaging Het
Pik3r6 T C 11: 68,539,927 V518A possibly damaging Het
Rab5a C T 17: 53,497,622 P87S probably damaging Het
Rbsn C T 6: 92,199,816 V239I possibly damaging Het
Rsph14 T A 10: 74,957,628 I314F possibly damaging Het
S1pr2 A T 9: 20,967,936 S199T probably benign Het
Scrib A G 15: 76,059,302 L902P probably damaging Het
Slc25a23 T C 17: 57,053,825 T200A probably damaging Het
Slc8a1 A T 17: 81,388,737 I956N probably damaging Het
Spef2 A G 15: 9,748,726 V15A possibly damaging Het
Stim1 T A 7: 102,435,440 V533E possibly damaging Het
Tpr T A 1: 150,395,286 L80Q probably benign Het
Trim67 C T 8: 124,794,312 R138* probably null Het
Ttn T C 2: 76,750,283 N23422S probably damaging Het
Uba6 A G 5: 86,112,652 *1023Q probably null Het
Vmn1r208 T C 13: 22,772,671 N219D possibly damaging Het
Vmn1r8 T A 6: 57,036,259 S98R probably damaging Het
Other mutations in Tbck
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Tbck APN 3 132743093 splice site probably null
IGL00492:Tbck APN 3 132722740 missense probably benign 0.00
IGL01020:Tbck APN 3 132727142 nonsense probably null
IGL01111:Tbck APN 3 132694407 missense probably damaging 1.00
IGL01299:Tbck APN 3 132724877 missense probably damaging 0.98
IGL02456:Tbck APN 3 132734714 splice site probably benign
IGL02554:Tbck APN 3 132751192 nonsense probably null
IGL02640:Tbck APN 3 132774486 missense probably benign 0.26
IGL02960:Tbck APN 3 132722783 missense probably benign 0.01
IGL03184:Tbck APN 3 132736103 missense probably damaging 1.00
IGL03246:Tbck APN 3 132774570 missense probably benign
fear-4 UTSW 3 132724916 critical splice donor site probably null
fuerchte UTSW 3 132722291 splice site probably benign
PIT1430001:Tbck UTSW 3 132722726 missense probably benign
PIT4802001:Tbck UTSW 3 132752666 missense probably damaging 1.00
R0113:Tbck UTSW 3 132743080 missense probably damaging 1.00
R0241:Tbck UTSW 3 132724875 missense probably benign
R0241:Tbck UTSW 3 132724875 missense probably benign
R0309:Tbck UTSW 3 132734407 nonsense probably null
R0375:Tbck UTSW 3 132751232 splice site probably benign
R0571:Tbck UTSW 3 132752642 missense probably damaging 1.00
R0831:Tbck UTSW 3 132722291 splice site probably benign
R1135:Tbck UTSW 3 132732191 missense probably damaging 0.97
R1184:Tbck UTSW 3 132837972 missense probably benign 0.01
R1560:Tbck UTSW 3 132838048 missense probably damaging 1.00
R1563:Tbck UTSW 3 132715693 missense possibly damaging 0.94
R1659:Tbck UTSW 3 132734355 missense probably damaging 1.00
R1799:Tbck UTSW 3 132774502 missense probably benign 0.01
R1830:Tbck UTSW 3 132838011 missense probably benign 0.40
R1884:Tbck UTSW 3 132724916 critical splice donor site probably null
R3406:Tbck UTSW 3 132727084 missense probably benign 0.41
R4021:Tbck UTSW 3 132727134 missense probably damaging 0.97
R4205:Tbck UTSW 3 132838028 missense probably benign 0.32
R4503:Tbck UTSW 3 132751220 missense probably benign 0.03
R4794:Tbck UTSW 3 132686968 missense possibly damaging 0.90
R4795:Tbck UTSW 3 132707798 missense possibly damaging 0.95
R4859:Tbck UTSW 3 132801527 missense probably benign 0.00
R5282:Tbck UTSW 3 132751216 missense possibly damaging 0.95
R5987:Tbck UTSW 3 132801517 missense possibly damaging 0.53
R6145:Tbck UTSW 3 132732215 missense probably damaging 1.00
R6147:Tbck UTSW 3 132694446 missense probably benign
R6242:Tbck UTSW 3 132694428 missense probably benign 0.16
R6276:Tbck UTSW 3 132743005 missense probably damaging 1.00
R6912:Tbck UTSW 3 132686942 missense possibly damaging 0.50
R7107:Tbck UTSW 3 132722331 missense possibly damaging 0.73
R7191:Tbck UTSW 3 132737555 missense probably damaging 1.00
X0018:Tbck UTSW 3 132686800 start codon destroyed probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCCACAGCAATTTGAAATTGG -3'
(R):5'- TCTCTGCAACTGAATTGAGAGC -3'

Sequencing Primer
(F):5'- AGAAGCTTTTCTACCTGTCATTTTG -3'
(R):5'- TAGTCATCAGAAAAGGACCACAATTC -3'
Posted On2016-12-15