Incidental Mutation 'R5787:Cyp3a25'
ID448075
Institutional Source Beutler Lab
Gene Symbol Cyp3a25
Ensembl Gene ENSMUSG00000029630
Gene Namecytochrome P450, family 3, subfamily a, polypeptide 25
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R5787 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location145977194-146009618 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 145998503 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 101 (V101A)
Ref Sequence ENSEMBL: ENSMUSP00000116077 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068317] [ENSMUST00000138870] [ENSMUST00000145062]
Predicted Effect probably benign
Transcript: ENSMUST00000068317
AA Change: V101A

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000065585
Gene: ENSMUSG00000029630
AA Change: V101A

DomainStartEndE-ValueType
Pfam:p450 38 493 9.4e-129 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138870
AA Change: V101A

PolyPhen 2 Score 0.135 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000116077
Gene: ENSMUSG00000029630
AA Change: V101A

DomainStartEndE-ValueType
Pfam:p450 38 126 2e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145062
AA Change: V101A

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000123615
Gene: ENSMUSG00000029630
AA Change: V101A

DomainStartEndE-ValueType
Pfam:p450 38 148 3.9e-21 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 36,992,733 probably null Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Adam24 A G 8: 40,680,902 N470D possibly damaging Het
Adcy8 T C 15: 64,704,218 D1027G probably damaging Het
Amph A T 13: 18,948,454 I8F possibly damaging Het
Ankrd60 TGGCCACGCGG TGG 2: 173,578,089 probably null Het
Ano5 G A 7: 51,566,318 D348N possibly damaging Het
Atp6v0a1 A G 11: 101,018,574 D43G probably benign Het
Btnl10 T A 11: 58,920,343 I164N probably damaging Het
Ccdc174 C T 6: 91,881,310 Q71* probably null Het
Ceacam3 G A 7: 17,155,046 E247K possibly damaging Het
Chrna2 A G 14: 66,149,008 D201G probably benign Het
Clasp2 G A 9: 113,862,242 D448N probably damaging Het
Clcn2 C A 16: 20,703,433 R829L probably damaging Het
Clock A G 5: 76,237,051 S440P probably damaging Het
Cntn2 T C 1: 132,523,059 D29G probably damaging Het
Cpne4 A G 9: 105,022,401 T428A probably benign Het
Cul3 T C 1: 80,282,721 I304V probably benign Het
Cyp11a1 C A 9: 58,015,267 Q77K probably benign Het
Cyp4f15 T C 17: 32,702,808 F485L probably damaging Het
Des T A 1: 75,363,646 V399E probably damaging Het
Dhx58 T C 11: 100,701,319 D301G possibly damaging Het
Ear6 A G 14: 51,854,398 E134G probably benign Het
Eif2b3 A G 4: 117,044,440 D100G probably damaging Het
Erich1 T C 8: 14,033,776 probably null Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Htr4 T C 18: 62,413,622 V82A probably damaging Het
Hydin A G 8: 110,326,353 D219G probably damaging Het
Ifit1 T A 19: 34,647,575 V37E probably benign Het
Isg20 T A 7: 78,919,810 D176E probably benign Het
Islr2 A G 9: 58,198,354 V585A probably damaging Het
Kat6a A G 8: 22,932,647 E991G probably damaging Het
Kcnv1 T C 15: 45,114,330 Y104C probably damaging Het
Lrtm1 G C 14: 29,021,990 E138D possibly damaging Het
Mllt3 A T 4: 87,840,820 D330E probably damaging Het
Mpp7 T C 18: 7,461,682 N64D probably benign Het
Naip6 G T 13: 100,300,216 Q600K probably benign Het
Nop9 T G 14: 55,746,334 C141G possibly damaging Het
Nos1ap T C 1: 170,318,572 E471G probably benign Het
Npr2 A G 4: 43,633,593 T246A possibly damaging Het
Olfr1249 T A 2: 89,630,674 I75F probably benign Het
Olfr1348 A T 7: 6,501,990 S79T probably damaging Het
Olfr31 A C 14: 14,328,725 M205L probably damaging Het
Pdlim4 T A 11: 54,055,216 D271V probably damaging Het
Pik3r6 T C 11: 68,539,927 V518A possibly damaging Het
Rab5a C T 17: 53,497,622 P87S probably damaging Het
Rbsn C T 6: 92,199,816 V239I possibly damaging Het
Rsph14 T A 10: 74,957,628 I314F possibly damaging Het
S1pr2 A T 9: 20,967,936 S199T probably benign Het
Scrib A G 15: 76,059,302 L902P probably damaging Het
Slc25a23 T C 17: 57,053,825 T200A probably damaging Het
Slc8a1 A T 17: 81,388,737 I956N probably damaging Het
Spef2 A G 15: 9,748,726 V15A possibly damaging Het
Stim1 T A 7: 102,435,440 V533E possibly damaging Het
Tbck A T 3: 132,737,568 D585V probably damaging Het
Tpr T A 1: 150,395,286 L80Q probably benign Het
Trim67 C T 8: 124,794,312 R138* probably null Het
Ttn T C 2: 76,750,283 N23422S probably damaging Het
Uba6 A G 5: 86,112,652 *1023Q probably null Het
Vmn1r208 T C 13: 22,772,671 N219D possibly damaging Het
Vmn1r8 T A 6: 57,036,259 S98R probably damaging Het
Other mutations in Cyp3a25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Cyp3a25 APN 5 146001463 nonsense probably null
IGL00430:Cyp3a25 APN 5 145993360 missense probably damaging 1.00
IGL00803:Cyp3a25 APN 5 146001443 splice site probably benign
IGL00928:Cyp3a25 APN 5 145986954 missense possibly damaging 0.94
IGL01557:Cyp3a25 APN 5 145984901 missense probably damaging 1.00
IGL01997:Cyp3a25 APN 5 145994956 missense possibly damaging 0.92
IGL02140:Cyp3a25 APN 5 146009463 splice site probably benign
IGL02267:Cyp3a25 APN 5 145998552 missense possibly damaging 0.48
IGL02272:Cyp3a25 APN 5 145993265 intron probably benign
IGL02327:Cyp3a25 APN 5 145986921 missense possibly damaging 0.50
IGL02411:Cyp3a25 APN 5 146001447 critical splice donor site probably benign
IGL02504:Cyp3a25 APN 5 145993331 missense probably benign 0.03
IGL02653:Cyp3a25 APN 5 146003110 missense possibly damaging 0.95
R0378:Cyp3a25 UTSW 5 145986842 missense probably damaging 1.00
R0403:Cyp3a25 UTSW 5 145998513 missense probably damaging 1.00
R0685:Cyp3a25 UTSW 5 145998546 missense probably damaging 1.00
R0725:Cyp3a25 UTSW 5 145994936 missense probably damaging 1.00
R0798:Cyp3a25 UTSW 5 145991533 missense probably damaging 0.98
R1061:Cyp3a25 UTSW 5 145986833 missense probably benign
R1519:Cyp3a25 UTSW 5 146001447 critical splice donor site probably null
R1628:Cyp3a25 UTSW 5 146001463 nonsense probably null
R1822:Cyp3a25 UTSW 5 145984953 missense probably damaging 1.00
R1824:Cyp3a25 UTSW 5 145984953 missense probably damaging 1.00
R1864:Cyp3a25 UTSW 5 145994929 missense probably damaging 0.98
R2062:Cyp3a25 UTSW 5 145986969 splice site probably benign
R2401:Cyp3a25 UTSW 5 145986968 critical splice acceptor site probably null
R2516:Cyp3a25 UTSW 5 146003027 splice site probably null
R3080:Cyp3a25 UTSW 5 145998531 missense probably benign 0.33
R3236:Cyp3a25 UTSW 5 146003128 splice site probably benign
R3694:Cyp3a25 UTSW 5 145989976 splice site probably null
R3730:Cyp3a25 UTSW 5 146003081 missense probably damaging 1.00
R4112:Cyp3a25 UTSW 5 146003031 missense probably benign 0.18
R4258:Cyp3a25 UTSW 5 145991438 missense probably damaging 1.00
R4651:Cyp3a25 UTSW 5 145994891 missense probably benign 0.01
R4788:Cyp3a25 UTSW 5 145985082 nonsense probably null
R4899:Cyp3a25 UTSW 5 145977671 missense possibly damaging 0.59
R4926:Cyp3a25 UTSW 5 145991456 missense probably damaging 1.00
R4952:Cyp3a25 UTSW 5 145991524 missense probably benign 0.01
R5270:Cyp3a25 UTSW 5 145981502 missense probably benign 0.36
R5595:Cyp3a25 UTSW 5 145994863 critical splice donor site probably null
R5659:Cyp3a25 UTSW 5 145991546 missense possibly damaging 0.69
R6307:Cyp3a25 UTSW 5 145994956 missense possibly damaging 0.92
R6380:Cyp3a25 UTSW 5 145998547 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AATGGTGGTGGCTCTTTACC -3'
(R):5'- CATCAGGGCTTGAGATTGAAATC -3'

Sequencing Primer
(F):5'- GCCCGCTGATCTTGATGTAGAAC -3'
(R):5'- AAATCTTGTGTGTGACTCCAGC -3'
Posted On2016-12-15