Incidental Mutation 'R5787:Adcy8'
ID448113
Institutional Source Beutler Lab
Gene Symbol Adcy8
Ensembl Gene ENSMUSG00000022376
Gene Nameadenylate cyclase 8
SynonymsAC8
Accession Numbers

Genbank: NM_009623; MGI: 1341110

Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock #R5787 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location64697084-64922296 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 64704218 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1027 (D1027G)
Ref Sequence ENSEMBL: ENSMUSP00000023007 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023007] [ENSMUST00000228014]
Predicted Effect probably damaging
Transcript: ENSMUST00000023007
AA Change: D1027G

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000023007
Gene: ENSMUSG00000022376
AA Change: D1027G

DomainStartEndE-ValueType
low complexity region 52 61 N/A INTRINSIC
low complexity region 111 123 N/A INTRINSIC
low complexity region 185 201 N/A INTRINSIC
low complexity region 255 271 N/A INTRINSIC
CYCc 363 565 3.16e-63 SMART
Pfam:DUF1053 615 710 1.3e-30 PFAM
transmembrane domain 741 759 N/A INTRINSIC
transmembrane domain 780 802 N/A INTRINSIC
transmembrane domain 833 852 N/A INTRINSIC
transmembrane domain 857 879 N/A INTRINSIC
low complexity region 900 911 N/A INTRINSIC
CYCc 940 1155 2.19e-48 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000228014
AA Change: D997G

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Adenylate cyclase is a membrane bound enzyme that catalyses the formation of cyclic AMP from ATP. The enzymatic activity is under the control of several hormones, and different polypeptides participate in the transduction of the signal from the receptor to the catalytic moiety. Stimulatory or inhibitory receptors (Rs and Ri) interact with G proteins (Gs and Gi) that exhibit GTPase activity and they modulate the activity of the catalytic subunit of the adenylyl cyclase [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in reduced body size (in female animals only), reduced anxiety, and impaired long term depression (LTD). [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 36,992,733 probably null Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Adam24 A G 8: 40,680,902 N470D possibly damaging Het
Amph A T 13: 18,948,454 I8F possibly damaging Het
Ankrd60 TGGCCACGCGG TGG 2: 173,578,089 probably null Het
Ano5 G A 7: 51,566,318 D348N possibly damaging Het
Atp6v0a1 A G 11: 101,018,574 D43G probably benign Het
Btnl10 T A 11: 58,920,343 I164N probably damaging Het
Ccdc174 C T 6: 91,881,310 Q71* probably null Het
Ceacam3 G A 7: 17,155,046 E247K possibly damaging Het
Chrna2 A G 14: 66,149,008 D201G probably benign Het
Clasp2 G A 9: 113,862,242 D448N probably damaging Het
Clcn2 C A 16: 20,703,433 R829L probably damaging Het
Clock A G 5: 76,237,051 S440P probably damaging Het
Cntn2 T C 1: 132,523,059 D29G probably damaging Het
Cpne4 A G 9: 105,022,401 T428A probably benign Het
Cul3 T C 1: 80,282,721 I304V probably benign Het
Cyp11a1 C A 9: 58,015,267 Q77K probably benign Het
Cyp3a25 A G 5: 145,998,503 V101A probably benign Het
Cyp4f15 T C 17: 32,702,808 F485L probably damaging Het
Des T A 1: 75,363,646 V399E probably damaging Het
Dhx58 T C 11: 100,701,319 D301G possibly damaging Het
Ear6 A G 14: 51,854,398 E134G probably benign Het
Eif2b3 A G 4: 117,044,440 D100G probably damaging Het
Erich1 T C 8: 14,033,776 probably null Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Htr4 T C 18: 62,413,622 V82A probably damaging Het
Hydin A G 8: 110,326,353 D219G probably damaging Het
Ifit1 T A 19: 34,647,575 V37E probably benign Het
Isg20 T A 7: 78,919,810 D176E probably benign Het
Islr2 A G 9: 58,198,354 V585A probably damaging Het
Kat6a A G 8: 22,932,647 E991G probably damaging Het
Kcnv1 T C 15: 45,114,330 Y104C probably damaging Het
Lrtm1 G C 14: 29,021,990 E138D possibly damaging Het
Mllt3 A T 4: 87,840,820 D330E probably damaging Het
Mpp7 T C 18: 7,461,682 N64D probably benign Het
Naip6 G T 13: 100,300,216 Q600K probably benign Het
Nop9 T G 14: 55,746,334 C141G possibly damaging Het
Nos1ap T C 1: 170,318,572 E471G probably benign Het
Npr2 A G 4: 43,633,593 T246A possibly damaging Het
Olfr1249 T A 2: 89,630,674 I75F probably benign Het
Olfr1348 A T 7: 6,501,990 S79T probably damaging Het
Olfr31 A C 14: 14,328,725 M205L probably damaging Het
Pdlim4 T A 11: 54,055,216 D271V probably damaging Het
Pik3r6 T C 11: 68,539,927 V518A possibly damaging Het
Rab5a C T 17: 53,497,622 P87S probably damaging Het
Rbsn C T 6: 92,199,816 V239I possibly damaging Het
Rsph14 T A 10: 74,957,628 I314F possibly damaging Het
S1pr2 A T 9: 20,967,936 S199T probably benign Het
Scrib A G 15: 76,059,302 L902P probably damaging Het
Slc25a23 T C 17: 57,053,825 T200A probably damaging Het
Slc8a1 A T 17: 81,388,737 I956N probably damaging Het
Spef2 A G 15: 9,748,726 V15A possibly damaging Het
Stim1 T A 7: 102,435,440 V533E possibly damaging Het
Tbck A T 3: 132,737,568 D585V probably damaging Het
Tpr T A 1: 150,395,286 L80Q probably benign Het
Trim67 C T 8: 124,794,312 R138* probably null Het
Ttn T C 2: 76,750,283 N23422S probably damaging Het
Uba6 A G 5: 86,112,652 *1023Q probably null Het
Vmn1r208 T C 13: 22,772,671 N219D possibly damaging Het
Vmn1r8 T A 6: 57,036,259 S98R probably damaging Het
Other mutations in Adcy8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00589:Adcy8 APN 15 64787367 missense probably damaging 1.00
IGL00690:Adcy8 APN 15 64699302 missense probably damaging 1.00
IGL00990:Adcy8 APN 15 64822313 missense probably benign 0.07
IGL01083:Adcy8 APN 15 64787342 missense probably benign 0.21
IGL01296:Adcy8 APN 15 64783779 missense probably damaging 0.98
IGL01433:Adcy8 APN 15 64737414 missense possibly damaging 0.63
IGL01584:Adcy8 APN 15 64815321 missense probably damaging 1.00
IGL01729:Adcy8 APN 15 64806662 missense probably damaging 1.00
IGL02023:Adcy8 APN 15 64822220 missense probably damaging 1.00
IGL02420:Adcy8 APN 15 64787454 missense probably damaging 1.00
IGL02613:Adcy8 APN 15 64783984 missense possibly damaging 0.82
IGL02662:Adcy8 APN 15 64746895 critical splice donor site probably null
IGL03180:Adcy8 APN 15 64783950 missense possibly damaging 0.77
IGL03327:Adcy8 APN 15 64920267 missense probably damaging 1.00
revolutionary UTSW 15 64699387 missense probably damaging 1.00
whirligig UTSW 15 64699285 missense probably damaging 1.00
F0336:Adcy8 UTSW 15 64822234 missense probably benign 0.38
K7894:Adcy8 UTSW 15 64822234 missense probably benign 0.38
PIT4581001:Adcy8 UTSW 15 64754817 missense probably damaging 1.00
R0035:Adcy8 UTSW 15 64699368 missense probably benign 0.29
R0119:Adcy8 UTSW 15 64716166 missense probably damaging 1.00
R0129:Adcy8 UTSW 15 64747013 missense probably benign 0.18
R0299:Adcy8 UTSW 15 64716166 missense probably damaging 1.00
R0573:Adcy8 UTSW 15 64822195 missense probably damaging 1.00
R0961:Adcy8 UTSW 15 64754862 missense possibly damaging 0.91
R1203:Adcy8 UTSW 15 64746931 missense probably damaging 1.00
R1239:Adcy8 UTSW 15 64716062 missense probably damaging 0.98
R1615:Adcy8 UTSW 15 64871776 missense probably benign 0.25
R1881:Adcy8 UTSW 15 64806654 missense probably damaging 0.96
R2013:Adcy8 UTSW 15 64767878 missense probably benign 0.00
R2014:Adcy8 UTSW 15 64767878 missense probably benign 0.00
R2015:Adcy8 UTSW 15 64767878 missense probably benign 0.00
R2164:Adcy8 UTSW 15 64920934 missense probably benign
R2228:Adcy8 UTSW 15 64822207 missense possibly damaging 0.58
R2229:Adcy8 UTSW 15 64822207 missense possibly damaging 0.58
R2241:Adcy8 UTSW 15 64699381 missense possibly damaging 0.78
R3177:Adcy8 UTSW 15 64699159 missense probably benign 0.10
R3277:Adcy8 UTSW 15 64699159 missense probably benign 0.10
R3404:Adcy8 UTSW 15 64699600 missense probably damaging 1.00
R3688:Adcy8 UTSW 15 64871707 missense probably damaging 0.99
R3709:Adcy8 UTSW 15 64725535 splice site probably benign
R3710:Adcy8 UTSW 15 64725535 splice site probably benign
R3778:Adcy8 UTSW 15 64746997 missense probably damaging 1.00
R4037:Adcy8 UTSW 15 64725470 missense probably benign 0.06
R4685:Adcy8 UTSW 15 64737438 missense probably benign 0.09
R4731:Adcy8 UTSW 15 64754862 missense possibly damaging 0.91
R4732:Adcy8 UTSW 15 64754862 missense possibly damaging 0.91
R4733:Adcy8 UTSW 15 64754862 missense possibly damaging 0.91
R5071:Adcy8 UTSW 15 64787358 missense probably damaging 1.00
R5073:Adcy8 UTSW 15 64787358 missense probably damaging 1.00
R5074:Adcy8 UTSW 15 64787358 missense probably damaging 1.00
R5091:Adcy8 UTSW 15 64806704 missense probably damaging 1.00
R5285:Adcy8 UTSW 15 64767857 missense possibly damaging 0.68
R5287:Adcy8 UTSW 15 64716152 missense probably benign 0.04
R5403:Adcy8 UTSW 15 64716152 missense probably benign 0.04
R5521:Adcy8 UTSW 15 64815350 missense probably damaging 1.00
R5633:Adcy8 UTSW 15 64699285 missense probably damaging 1.00
R5712:Adcy8 UTSW 15 64754866 missense probably damaging 1.00
R5745:Adcy8 UTSW 15 64920471 missense possibly damaging 0.91
R5839:Adcy8 UTSW 15 64716182 missense probably damaging 1.00
R5890:Adcy8 UTSW 15 64815417 missense probably damaging 1.00
R6156:Adcy8 UTSW 15 64817639 unclassified probably null
R6338:Adcy8 UTSW 15 64920617 missense possibly damaging 0.94
R6516:Adcy8 UTSW 15 64699387 missense probably damaging 1.00
R6525:Adcy8 UTSW 15 64737394 nonsense probably null
R6636:Adcy8 UTSW 15 64787402 missense probably damaging 1.00
R6823:Adcy8 UTSW 15 64754886 critical splice acceptor site probably null
R7007:Adcy8 UTSW 15 64704716 missense possibly damaging 0.88
R7070:Adcy8 UTSW 15 64920555 missense probably damaging 1.00
R7092:Adcy8 UTSW 15 64871770 missense possibly damaging 0.93
R7371:Adcy8 UTSW 15 64699218 missense probably benign 0.19
R7457:Adcy8 UTSW 15 64920680 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- ATCCTGCAACAGCTCCCTC -3'
(R):5'- AGCATCAGAACTCTTGGGATGTTTTA -3'

Sequencing Primer
(F):5'- GCAACAGCTCCCTCCCATTG -3'
(R):5'- TTAGTCACCACAGTGTGCAATGG -3'
Posted On2016-12-15