Incidental Mutation 'R0546:Ccdc180'
ID44812
Institutional Source Beutler Lab
Gene Symbol Ccdc180
Ensembl Gene ENSMUSG00000035539
Gene Namecoiled-coil domain containing 180
SynonymsE230008N13Rik, LOC381522
MMRRC Submission 038738-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R0546 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location45890303-45950774 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 45904597 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 398 (T398S)
Ref Sequence ENSEMBL: ENSMUSP00000136714 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000178561]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127261
Predicted Effect unknown
Transcript: ENSMUST00000149903
AA Change: T390S
SMART Domains Protein: ENSMUSP00000119784
Gene: ENSMUSG00000035539
AA Change: T390S

DomainStartEndE-ValueType
low complexity region 25 42 N/A INTRINSIC
coiled coil region 90 117 N/A INTRINSIC
Pfam:DUF4455 141 609 2e-189 PFAM
low complexity region 628 642 N/A INTRINSIC
low complexity region 658 675 N/A INTRINSIC
coiled coil region 710 780 N/A INTRINSIC
coiled coil region 945 979 N/A INTRINSIC
low complexity region 1100 1123 N/A INTRINSIC
Pfam:DUF4456 1169 1372 9.5e-77 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000178561
AA Change: T398S

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000136714
Gene: ENSMUSG00000035539
AA Change: T398S

DomainStartEndE-ValueType
low complexity region 32 49 N/A INTRINSIC
coiled coil region 98 125 N/A INTRINSIC
Pfam:DUF4455 148 616 7.3e-189 PFAM
low complexity region 635 649 N/A INTRINSIC
low complexity region 665 682 N/A INTRINSIC
coiled coil region 718 788 N/A INTRINSIC
coiled coil region 1121 1155 N/A INTRINSIC
low complexity region 1275 1298 N/A INTRINSIC
Pfam:DUF4456 1344 1547 2.2e-76 PFAM
Meta Mutation Damage Score 0.0748 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a coiled-coil domain. Alternative splicing results in multiple transcript variants encoding different isoforms. A single nucleotide polymorphism (SNP) in this gene has been associated with increased susceptibility to Behcet's Disease (PMID: 19442274). [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass A G 6: 23,077,077 probably null Het
Actn1 C T 12: 80,178,434 R418Q probably benign Het
Adam39 G A 8: 40,826,431 V620M probably damaging Het
Agr3 C A 12: 35,928,330 T14K probably benign Het
Alpk2 T C 18: 65,306,717 D1002G probably benign Het
Amz2 T A 11: 109,433,954 N221K probably benign Het
Aox4 A G 1: 58,250,174 E752G probably damaging Het
Ap2a1 C T 7: 44,904,708 G500S probably damaging Het
Car5b G A X: 163,979,301 R282C probably damaging Het
Ccdc112 A G 18: 46,291,072 S200P possibly damaging Het
Ccdc18 A T 5: 108,174,964 E643D probably benign Het
Cnp A G 11: 100,580,723 Y397C probably damaging Het
Cpa4 T C 6: 30,580,963 W184R probably damaging Het
Crebbp A T 16: 4,085,807 I1856N probably damaging Het
Ctrl A G 8: 105,932,334 I200T probably damaging Het
Cyfip1 C T 7: 55,922,816 R934* probably null Het
Dennd5a A G 7: 109,921,426 V408A probably benign Het
Dhfr G A 13: 92,368,184 probably null Het
Dnajc6 A T 4: 101,635,191 N740Y probably damaging Het
Fam110a T C 2: 151,970,812 T13A probably benign Het
Fars2 G T 13: 36,204,586 K19N probably benign Het
Fer1l6 A T 15: 58,558,408 probably null Het
Gabra1 T A 11: 42,162,601 T69S probably damaging Het
Galnt18 T G 7: 111,508,141 N475T probably damaging Het
Gbp4 T C 5: 105,120,970 Y439C probably damaging Het
Gpatch2l A G 12: 86,288,848 *409W probably null Het
Hip1r T C 5: 123,999,051 V658A possibly damaging Het
Hspg2 A G 4: 137,502,294 D73G probably benign Het
Ifitm2 A G 7: 140,955,743 V58A possibly damaging Het
Ift172 T C 5: 31,257,601 D1359G probably benign Het
Ing1 A G 8: 11,557,031 D41G probably damaging Het
Itgal C T 7: 127,310,314 T446I probably benign Het
Itgav G T 2: 83,803,242 M978I probably benign Het
Jazf1 A G 6: 52,777,696 Y132H possibly damaging Het
Lgr4 T A 2: 109,999,421 N211K probably damaging Het
Mgat4d A G 8: 83,355,721 N100S possibly damaging Het
Mrgprb3 T C 7: 48,643,515 Y96C probably damaging Het
Myh11 A C 16: 14,205,628 L1562R probably damaging Het
Mylk G C 16: 34,879,475 E403Q possibly damaging Het
Myo15 A G 11: 60,506,313 Y2667C probably damaging Het
Olfr1084 T A 2: 86,639,229 T160S possibly damaging Het
Olfr1085 C T 2: 86,657,891 C189Y possibly damaging Het
Olfr1158 T A 2: 87,990,472 Y120* probably null Het
Olfr128 T A 17: 37,924,338 C257* probably null Het
Olfr608 A G 7: 103,470,700 I220M possibly damaging Het
Olfr814 G A 10: 129,874,538 T73I possibly damaging Het
Paox G T 7: 140,131,678 G148W probably damaging Het
Pkd1 T C 17: 24,580,138 V2777A probably benign Het
Plod2 T A 9: 92,595,335 V360E probably damaging Het
Prune2 T C 19: 17,020,666 probably benign Het
Sbds G T 5: 130,254,078 A3D possibly damaging Het
Sec23a T C 12: 58,985,167 T426A probably benign Het
Sec31a T C 5: 100,404,070 Y148C probably damaging Het
Shprh T A 10: 11,183,887 probably benign Het
Slc16a7 A G 10: 125,230,873 V299A probably benign Het
Smg8 T C 11: 87,083,613 Y174C possibly damaging Het
Snx22 T A 9: 66,068,777 Y58F probably damaging Het
Snx25 A G 8: 46,103,630 Y308H probably benign Het
St3gal2 A G 8: 110,970,106 probably null Het
Stab1 C T 14: 31,139,550 R2500H possibly damaging Het
Steap4 T C 5: 7,975,870 S144P probably damaging Het
Stfa3 T A 16: 36,452,257 probably benign Het
Tmprss9 C A 10: 80,899,323 Q1095K probably benign Het
Top2a A G 11: 98,999,226 V1217A possibly damaging Het
Trhr2 A G 8: 122,358,489 probably null Het
Trim7 A G 11: 48,845,509 E23G probably damaging Het
Trpv3 A T 11: 73,297,187 E788V probably damaging Het
Ttn A G 2: 76,745,519 I25010T probably damaging Het
Ube2ql1 T C 13: 69,739,300 H14R unknown Het
Uggt1 C T 1: 36,195,971 R419H probably benign Het
Xpo4 A G 14: 57,613,274 V391A probably benign Het
Zfhx3 A G 8: 108,794,187 D647G probably damaging Het
Zfp354c A T 11: 50,815,630 M206K probably benign Het
Zfp804a A G 2: 82,258,920 N1031S possibly damaging Het
Zfp868 A G 8: 69,612,231 V151A probably benign Het
Other mutations in Ccdc180
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01369:Ccdc180 APN 4 45900256 missense probably benign
IGL01713:Ccdc180 APN 4 45921025 critical splice donor site probably null
IGL01915:Ccdc180 APN 4 45904544 missense probably damaging 0.98
IGL01935:Ccdc180 APN 4 45906889 missense possibly damaging 0.71
IGL02539:Ccdc180 APN 4 45921005 missense probably damaging 1.00
IGL02982:Ccdc180 APN 4 45903840 splice site probably benign
IGL03071:Ccdc180 APN 4 45903840 splice site probably benign
IGL03146:Ccdc180 APN 4 45903840 splice site probably benign
PIT4687001:Ccdc180 UTSW 4 45949526 missense probably damaging 1.00
R0049:Ccdc180 UTSW 4 45930119 critical splice acceptor site probably null
R0049:Ccdc180 UTSW 4 45930119 critical splice acceptor site probably null
R0054:Ccdc180 UTSW 4 45890900 missense probably benign 0.01
R0054:Ccdc180 UTSW 4 45890900 missense probably benign 0.01
R0080:Ccdc180 UTSW 4 45896205 missense probably null 0.00
R0082:Ccdc180 UTSW 4 45896205 missense probably null 0.00
R0126:Ccdc180 UTSW 4 45912866 critical splice donor site probably null
R0193:Ccdc180 UTSW 4 45914803 missense probably benign 0.01
R0276:Ccdc180 UTSW 4 45923534 missense probably damaging 1.00
R0362:Ccdc180 UTSW 4 45923551 missense probably damaging 1.00
R0380:Ccdc180 UTSW 4 45930197 critical splice donor site probably null
R0468:Ccdc180 UTSW 4 45923271 missense possibly damaging 0.87
R0539:Ccdc180 UTSW 4 45922010 missense probably damaging 0.97
R0543:Ccdc180 UTSW 4 45900041 nonsense probably null
R0612:Ccdc180 UTSW 4 45927969 missense probably damaging 0.98
R0792:Ccdc180 UTSW 4 45927975 missense possibly damaging 0.92
R1056:Ccdc180 UTSW 4 45916375 missense probably benign 0.01
R1099:Ccdc180 UTSW 4 45914225 missense probably benign 0.03
R1136:Ccdc180 UTSW 4 45914589 missense probably benign 0.00
R1263:Ccdc180 UTSW 4 45903887 missense possibly damaging 0.85
R1331:Ccdc180 UTSW 4 45909359 missense possibly damaging 0.51
R1522:Ccdc180 UTSW 4 45927975 missense possibly damaging 0.92
R1819:Ccdc180 UTSW 4 45926195 missense possibly damaging 0.84
R2022:Ccdc180 UTSW 4 45944418 missense probably benign 0.18
R2056:Ccdc180 UTSW 4 45932477 missense probably benign 0.03
R2219:Ccdc180 UTSW 4 45944949 missense probably damaging 1.00
R2228:Ccdc180 UTSW 4 45948856 critical splice donor site probably null
R2229:Ccdc180 UTSW 4 45948856 critical splice donor site probably null
R2255:Ccdc180 UTSW 4 45921996 missense probably damaging 1.00
R2427:Ccdc180 UTSW 4 45929545 missense probably benign 0.03
R3001:Ccdc180 UTSW 4 45899988 missense probably benign
R3002:Ccdc180 UTSW 4 45899988 missense probably benign
R3003:Ccdc180 UTSW 4 45899988 missense probably benign
R3110:Ccdc180 UTSW 4 45900470 missense possibly damaging 0.86
R3111:Ccdc180 UTSW 4 45900470 missense possibly damaging 0.86
R3112:Ccdc180 UTSW 4 45900470 missense possibly damaging 0.86
R3898:Ccdc180 UTSW 4 45912799 missense possibly damaging 0.71
R4022:Ccdc180 UTSW 4 45904560 nonsense probably null
R4084:Ccdc180 UTSW 4 45950632 missense probably benign 0.19
R4377:Ccdc180 UTSW 4 45941877 missense probably damaging 1.00
R4595:Ccdc180 UTSW 4 45945023 missense probably damaging 0.98
R4637:Ccdc180 UTSW 4 45914443 missense probably benign
R4811:Ccdc180 UTSW 4 45928020 missense probably damaging 1.00
R4825:Ccdc180 UTSW 4 45912794 missense possibly damaging 0.93
R4858:Ccdc180 UTSW 4 45923244 missense probably damaging 1.00
R4888:Ccdc180 UTSW 4 45909308 missense probably damaging 0.98
R4940:Ccdc180 UTSW 4 45917453 missense probably damaging 0.96
R4940:Ccdc180 UTSW 4 45917508 missense probably damaging 1.00
R5042:Ccdc180 UTSW 4 45916255 missense probably damaging 0.98
R5119:Ccdc180 UTSW 4 45914603 missense possibly damaging 0.72
R5177:Ccdc180 UTSW 4 45917508 missense probably damaging 1.00
R5311:Ccdc180 UTSW 4 45917556 missense probably damaging 1.00
R5333:Ccdc180 UTSW 4 45890935 missense possibly damaging 0.53
R5448:Ccdc180 UTSW 4 45920913 missense probably damaging 1.00
R5510:Ccdc180 UTSW 4 45928046 missense probably damaging 0.96
R6018:Ccdc180 UTSW 4 45926235 missense probably damaging 1.00
R6108:Ccdc180 UTSW 4 45911389 missense possibly damaging 0.71
R6283:Ccdc180 UTSW 4 45902486 missense possibly damaging 0.85
R6483:Ccdc180 UTSW 4 45921950 missense probably benign 0.32
R6618:Ccdc180 UTSW 4 45950708 missense probably damaging 1.00
R7017:Ccdc180 UTSW 4 45940934 missense possibly damaging 0.84
X0017:Ccdc180 UTSW 4 45909350 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- AGATTGGTCCTGCCAAAGAGTTCAC -3'
(R):5'- AGCAGAGACTCTGTGTCTTTCTCCC -3'

Sequencing Primer
(F):5'- AGGTCTGATAAAACATGGTCCC -3'
(R):5'- TCAGGGGTCAGAATTTGAGGC -3'
Posted On2013-06-11