Incidental Mutation 'R5788:Olfr503'
ID448148
Institutional Source Beutler Lab
Gene Symbol Olfr503
Ensembl Gene ENSMUSG00000060759
Gene Nameolfactory receptor 503
SynonymsGA_x6K02T2PBJ9-10874315-10875286, Olfr1548, MOR34-8P, MOR34-9, MOR34-9, MOR34-12
MMRRC Submission 043382-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R5788 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location108544527-108545498 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 108545344 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 271 (I271T)
Ref Sequence ENSEMBL: ENSMUSP00000147778 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078162] [ENSMUST00000211693]
Predicted Effect probably damaging
Transcript: ENSMUST00000078162
AA Change: I273T

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000077296
Gene: ENSMUSG00000060759
AA Change: I273T

DomainStartEndE-ValueType
Pfam:7tm_4 35 315 3e-103 PFAM
Pfam:7TM_GPCR_Srsx 39 268 2.4e-7 PFAM
Pfam:7tm_1 45 297 9.2e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000211693
AA Change: I271T

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
Meta Mutation Damage Score 0.07 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.2%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadsb A G 7: 131,443,599 Y420C probably benign Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Amfr T A 8: 94,000,314 R90S probably damaging Het
Ankrd60 TGGCCACGCGG TGG 2: 173,578,089 probably null Het
Ano5 G A 7: 51,566,318 D348N possibly damaging Het
Atp8a2 T A 14: 60,020,793 D440V probably damaging Het
Bahcc1 A G 11: 120,286,352 D2022G probably damaging Het
Bicd1 T C 6: 149,484,000 F77S probably benign Het
Ccdc66 C T 14: 27,498,491 R255H probably benign Het
Ckm A G 7: 19,419,447 D152G probably benign Het
Cpsf7 T G 19: 10,540,718 S431A possibly damaging Het
Csmd1 T C 8: 16,201,966 T959A probably damaging Het
Dkk4 T C 8: 22,625,331 C66R probably damaging Het
Espl1 T A 15: 102,324,030 W2058R probably damaging Het
Evi5l A T 8: 4,206,800 probably benign Het
Fancg A T 4: 43,007,130 probably benign Het
Flg2 A T 3: 93,200,989 H108L probably benign Het
Fzd2 A T 11: 102,605,467 T246S probably benign Het
Gm10428 T G 11: 62,753,281 probably benign Het
Gm1988 T A 7: 39,172,203 noncoding transcript Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Gm7133 A T 1: 97,243,476 noncoding transcript Het
Grin2b T C 6: 135,740,964 N710S probably benign Het
Hcn2 T C 10: 79,717,111 V148A possibly damaging Het
Hephl1 A G 9: 15,084,283 L483S possibly damaging Het
Hinfp C T 9: 44,297,808 E338K possibly damaging Het
Hsd17b4 G A 18: 50,173,709 D494N probably damaging Het
Ipo4 C T 14: 55,628,820 V801M probably benign Het
Kcns2 A C 15: 34,838,854 Y121S probably benign Het
Kif1c T A 11: 70,708,828 L462H probably damaging Het
Lrrk2 T G 15: 91,764,648 V1615G possibly damaging Het
Naca G A 10: 128,040,142 probably benign Het
Naip6 G T 13: 100,300,216 Q600K probably benign Het
Ndufs2 A G 1: 171,239,385 Y135H probably damaging Het
Nwd2 T C 5: 63,807,771 V1566A probably benign Het
Olfr1102 A G 2: 87,002,301 T111A probably benign Het
Olfr607 C T 7: 103,460,879 V110I possibly damaging Het
Olfr790 A T 10: 129,500,894 L3F probably benign Het
Olfr790 A G 10: 129,500,910 M1V probably null Het
Pcid2 C T 8: 13,100,320 probably null Het
Pld4 A C 12: 112,764,117 I145L probably benign Het
Pogk A T 1: 166,409,011 probably benign Het
Rhbg C T 3: 88,245,567 V280I probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rxfp3 A G 15: 11,036,164 F374S possibly damaging Het
Son A G 16: 91,660,052 probably benign Het
Specc1l G T 10: 75,276,921 R994L probably damaging Het
Tas2r135 T A 6: 42,405,597 D23E probably damaging Het
Teddm2 A T 1: 153,851,064 H21Q probably benign Het
Tet1 T C 10: 62,839,958 T780A possibly damaging Het
Thbs1 T A 2: 118,122,508 D866E probably damaging Het
Tmed4 A G 11: 6,271,743 W198R probably damaging Het
Ttn A T 2: 76,919,231 C3825S probably benign Het
Uchl1 T A 5: 66,676,411 probably benign Het
Wsb2 A G 5: 117,377,418 T363A possibly damaging Het
Zfp266 A G 9: 20,506,036 Y19H probably damaging Het
Zkscan17 A G 11: 59,487,260 C366R probably damaging Het
Other mutations in Olfr503
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01308:Olfr503 APN 7 108544726 nonsense probably null
IGL02031:Olfr503 APN 7 108544930 missense probably benign 0.03
IGL02426:Olfr503 APN 7 108544980 missense probably benign 0.01
IGL02502:Olfr503 APN 7 108544639 missense probably damaging 1.00
IGL03208:Olfr503 APN 7 108545119 missense probably benign 0.02
R0507:Olfr503 UTSW 7 108545085 missense probably damaging 0.98
R0967:Olfr503 UTSW 7 108544789 missense probably damaging 1.00
R1181:Olfr503 UTSW 7 108545302 missense probably benign 0.00
R1501:Olfr503 UTSW 7 108544575 missense probably benign
R1596:Olfr503 UTSW 7 108545083 missense possibly damaging 0.90
R1657:Olfr503 UTSW 7 108545377 missense possibly damaging 0.50
R1708:Olfr503 UTSW 7 108544574 missense probably benign 0.04
R2215:Olfr503 UTSW 7 108544888 missense probably damaging 1.00
R4131:Olfr503 UTSW 7 108544537 nonsense probably null
R4772:Olfr503 UTSW 7 108544885 missense probably damaging 0.98
R5009:Olfr503 UTSW 7 108544848 missense probably benign 0.01
R5297:Olfr503 UTSW 7 108545404 missense probably damaging 1.00
R5944:Olfr503 UTSW 7 108545277 missense possibly damaging 0.90
R6522:Olfr503 UTSW 7 108544995 missense probably benign 0.09
R7045:Olfr503 UTSW 7 108545245 missense probably damaging 1.00
R7339:Olfr503 UTSW 7 108544900 missense probably damaging 1.00
R7558:Olfr503 UTSW 7 108544721 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGTCTGTAGCCAAGTTGCCC -3'
(R):5'- TCTCTGTTGCCCTGCCAAAG -3'

Sequencing Primer
(F):5'- CCCTGTGGCAATGTCAAGGTG -3'
(R):5'- GCCCTGCCAAAGCTTATTTATATAC -3'
Posted On2016-12-15