Incidental Mutation 'R5788:Rnd2'
ID448168
Institutional Source Beutler Lab
Gene Symbol Rnd2
Ensembl Gene ENSMUSG00000001313
Gene NameRho family GTPase 2
SynonymsArhn, Rohn
MMRRC Submission 043382-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5788 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location101464999-101471853 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 101468999 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 57 (L57F)
Ref Sequence ENSEMBL: ENSMUSP00000001347 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001347] [ENSMUST00000040430]
Predicted Effect probably damaging
Transcript: ENSMUST00000001347
AA Change: L57F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000001347
Gene: ENSMUSG00000001313
AA Change: L57F

DomainStartEndE-ValueType
RHO 10 184 5.22e-100 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000040430
SMART Domains Protein: ENSMUSP00000048350
Gene: ENSMUSG00000034993

DomainStartEndE-ValueType
low complexity region 3 31 N/A INTRINSIC
low complexity region 41 60 N/A INTRINSIC
Pfam:ADH_N 89 157 8.8e-11 PFAM
Pfam:ADH_zinc_N 213 355 2.1e-21 PFAM
Pfam:ADH_zinc_N_2 245 398 6.9e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134980
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153185
Meta Mutation Damage Score 0.218 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.2%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Rho GTPase family, whose members play a key role in the regulation of actin cytoskeleton organization in response to extracellular growth factors. This particular family member has been implicated in the regulation of neuronal morphology and endosomal trafficking. The gene localizes to chromosome 17 and is the centromeric neighbor of the breast-ovarian cancer susceptibility gene BRCA1. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadsb A G 7: 131,443,599 Y420C probably benign Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Amfr T A 8: 94,000,314 R90S probably damaging Het
Ankrd60 TGGCCACGCGG TGG 2: 173,578,089 probably null Het
Ano5 G A 7: 51,566,318 D348N possibly damaging Het
Atp8a2 T A 14: 60,020,793 D440V probably damaging Het
Bahcc1 A G 11: 120,286,352 D2022G probably damaging Het
Bicd1 T C 6: 149,484,000 F77S probably benign Het
Ccdc66 C T 14: 27,498,491 R255H probably benign Het
Ckm A G 7: 19,419,447 D152G probably benign Het
Cpsf7 T G 19: 10,540,718 S431A possibly damaging Het
Csmd1 T C 8: 16,201,966 T959A probably damaging Het
Dkk4 T C 8: 22,625,331 C66R probably damaging Het
Espl1 T A 15: 102,324,030 W2058R probably damaging Het
Evi5l A T 8: 4,206,800 probably benign Het
Fancg A T 4: 43,007,130 probably benign Het
Flg2 A T 3: 93,200,989 H108L probably benign Het
Fzd2 A T 11: 102,605,467 T246S probably benign Het
Gm10428 T G 11: 62,753,281 probably benign Het
Gm1988 T A 7: 39,172,203 noncoding transcript Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Gm7133 A T 1: 97,243,476 noncoding transcript Het
Grin2b T C 6: 135,740,964 N710S probably benign Het
Hcn2 T C 10: 79,717,111 V148A possibly damaging Het
Hephl1 A G 9: 15,084,283 L483S possibly damaging Het
Hinfp C T 9: 44,297,808 E338K possibly damaging Het
Hsd17b4 G A 18: 50,173,709 D494N probably damaging Het
Ipo4 C T 14: 55,628,820 V801M probably benign Het
Kcns2 A C 15: 34,838,854 Y121S probably benign Het
Kif1c T A 11: 70,708,828 L462H probably damaging Het
Lrrk2 T G 15: 91,764,648 V1615G possibly damaging Het
Naca G A 10: 128,040,142 probably benign Het
Naip6 G T 13: 100,300,216 Q600K probably benign Het
Ndufs2 A G 1: 171,239,385 Y135H probably damaging Het
Nwd2 T C 5: 63,807,771 V1566A probably benign Het
Olfr1102 A G 2: 87,002,301 T111A probably benign Het
Olfr503 T C 7: 108,545,344 I271T probably damaging Het
Olfr607 C T 7: 103,460,879 V110I possibly damaging Het
Olfr790 A T 10: 129,500,894 L3F probably benign Het
Olfr790 A G 10: 129,500,910 M1V probably null Het
Pcid2 C T 8: 13,100,320 probably null Het
Pld4 A C 12: 112,764,117 I145L probably benign Het
Pogk A T 1: 166,409,011 probably benign Het
Rhbg C T 3: 88,245,567 V280I probably benign Het
Rxfp3 A G 15: 11,036,164 F374S possibly damaging Het
Son A G 16: 91,660,052 probably benign Het
Specc1l G T 10: 75,276,921 R994L probably damaging Het
Tas2r135 T A 6: 42,405,597 D23E probably damaging Het
Teddm2 A T 1: 153,851,064 H21Q probably benign Het
Tet1 T C 10: 62,839,958 T780A possibly damaging Het
Thbs1 T A 2: 118,122,508 D866E probably damaging Het
Tmed4 A G 11: 6,271,743 W198R probably damaging Het
Ttn A T 2: 76,919,231 C3825S probably benign Het
Uchl1 T A 5: 66,676,411 probably benign Het
Wsb2 A G 5: 117,377,418 T363A possibly damaging Het
Zfp266 A G 9: 20,506,036 Y19H probably damaging Het
Zkscan17 A G 11: 59,487,260 C366R probably damaging Het
Other mutations in Rnd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00596:Rnd2 APN 11 101471191 missense possibly damaging 0.81
IGL01964:Rnd2 APN 11 101470806 unclassified probably null
Atkins UTSW 11 101468999 missense probably damaging 1.00
R1581:Rnd2 UTSW 11 101471196 missense probably benign
R4606:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R4797:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R4824:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R4825:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R4931:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5005:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5078:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5079:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5402:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5405:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5497:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5498:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5501:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5534:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5619:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5666:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5669:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5670:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5671:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5786:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5844:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5845:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5857:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5989:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5991:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R5992:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6018:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6019:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6020:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6122:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6144:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6148:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6208:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6209:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6226:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6230:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6332:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6333:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6335:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6491:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6541:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6605:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6606:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6607:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6677:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6678:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6726:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6796:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
R6797:Rnd2 UTSW 11 101468999 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGTCTAGGGACTGAGCTG -3'
(R):5'- CAGGGCCGATATTAGACTTCCTAC -3'

Sequencing Primer
(F):5'- TCTAGGGACTGAGCTGGACCG -3'
(R):5'- GGTTTCTGTCAGGCCTAAGAAACTC -3'
Posted On2016-12-15