Incidental Mutation 'R5788:Gm4787'
ID448171
Institutional Source Beutler Lab
Gene Symbol Gm4787
Ensembl Gene ENSMUSG00000072974
Gene Namepredicted gene 4787
Synonyms
MMRRC Submission 043382-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R5788 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location81376991-81379464 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 81377830 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 518 (T518S)
Ref Sequence ENSEMBL: ENSMUSP00000077390 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062182] [ENSMUST00000110340] [ENSMUST00000164386] [ENSMUST00000166723]
Predicted Effect probably benign
Transcript: ENSMUST00000062182
AA Change: T518S

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000077390
Gene: ENSMUSG00000072974
AA Change: T518S

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Pfam:Pep_M12B_propep 46 163 1.5e-19 PFAM
Pfam:Reprolysin 213 406 4.6e-18 PFAM
DISIN 425 500 2e-33 SMART
ACR 501 644 2.83e-53 SMART
transmembrane domain 714 736 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000087222
Predicted Effect probably benign
Transcript: ENSMUST00000110340
SMART Domains Protein: ENSMUSP00000105969
Gene: ENSMUSG00000091803

DomainStartEndE-ValueType
Pfam:COX16 16 74 6.6e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164386
SMART Domains Protein: ENSMUSP00000132941
Gene: ENSMUSG00000021139

DomainStartEndE-ValueType
PDZ 21 100 6.16e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166723
SMART Domains Protein: ENSMUSP00000130935
Gene: ENSMUSG00000091803

DomainStartEndE-ValueType
Pfam:COX16 16 73 6.9e-16 PFAM
Meta Mutation Damage Score 0.0648 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.2%
Validation Efficiency 98% (62/63)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadsb A G 7: 131,443,599 Y420C probably benign Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Amfr T A 8: 94,000,314 R90S probably damaging Het
Ankrd60 TGGCCACGCGG TGG 2: 173,578,089 probably null Het
Ano5 G A 7: 51,566,318 D348N possibly damaging Het
Atp8a2 T A 14: 60,020,793 D440V probably damaging Het
Bahcc1 A G 11: 120,286,352 D2022G probably damaging Het
Bicd1 T C 6: 149,484,000 F77S probably benign Het
Ccdc66 C T 14: 27,498,491 R255H probably benign Het
Ckm A G 7: 19,419,447 D152G probably benign Het
Cpsf7 T G 19: 10,540,718 S431A possibly damaging Het
Csmd1 T C 8: 16,201,966 T959A probably damaging Het
Dkk4 T C 8: 22,625,331 C66R probably damaging Het
Espl1 T A 15: 102,324,030 W2058R probably damaging Het
Evi5l A T 8: 4,206,800 probably benign Het
Fancg A T 4: 43,007,130 probably benign Het
Flg2 A T 3: 93,200,989 H108L probably benign Het
Fzd2 A T 11: 102,605,467 T246S probably benign Het
Gm10428 T G 11: 62,753,281 probably benign Het
Gm1988 T A 7: 39,172,203 noncoding transcript Het
Gm7133 A T 1: 97,243,476 noncoding transcript Het
Grin2b T C 6: 135,740,964 N710S probably benign Het
Hcn2 T C 10: 79,717,111 V148A possibly damaging Het
Hephl1 A G 9: 15,084,283 L483S possibly damaging Het
Hinfp C T 9: 44,297,808 E338K possibly damaging Het
Hsd17b4 G A 18: 50,173,709 D494N probably damaging Het
Ipo4 C T 14: 55,628,820 V801M probably benign Het
Kcns2 A C 15: 34,838,854 Y121S probably benign Het
Kif1c T A 11: 70,708,828 L462H probably damaging Het
Lrrk2 T G 15: 91,764,648 V1615G possibly damaging Het
Naca G A 10: 128,040,142 probably benign Het
Naip6 G T 13: 100,300,216 Q600K probably benign Het
Ndufs2 A G 1: 171,239,385 Y135H probably damaging Het
Nwd2 T C 5: 63,807,771 V1566A probably benign Het
Olfr1102 A G 2: 87,002,301 T111A probably benign Het
Olfr503 T C 7: 108,545,344 I271T probably damaging Het
Olfr607 C T 7: 103,460,879 V110I possibly damaging Het
Olfr790 A T 10: 129,500,894 L3F probably benign Het
Olfr790 A G 10: 129,500,910 M1V probably null Het
Pcid2 C T 8: 13,100,320 probably null Het
Pld4 A C 12: 112,764,117 I145L probably benign Het
Pogk A T 1: 166,409,011 probably benign Het
Rhbg C T 3: 88,245,567 V280I probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rxfp3 A G 15: 11,036,164 F374S possibly damaging Het
Son A G 16: 91,660,052 probably benign Het
Specc1l G T 10: 75,276,921 R994L probably damaging Het
Tas2r135 T A 6: 42,405,597 D23E probably damaging Het
Teddm2 A T 1: 153,851,064 H21Q probably benign Het
Tet1 T C 10: 62,839,958 T780A possibly damaging Het
Thbs1 T A 2: 118,122,508 D866E probably damaging Het
Tmed4 A G 11: 6,271,743 W198R probably damaging Het
Ttn A T 2: 76,919,231 C3825S probably benign Het
Uchl1 T A 5: 66,676,411 probably benign Het
Wsb2 A G 5: 117,377,418 T363A possibly damaging Het
Zfp266 A G 9: 20,506,036 Y19H probably damaging Het
Zkscan17 A G 11: 59,487,260 C366R probably damaging Het
Other mutations in Gm4787
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01719:Gm4787 APN 12 81377174 missense possibly damaging 0.50
IGL01916:Gm4787 APN 12 81377444 missense probably benign 0.36
IGL02193:Gm4787 APN 12 81378528 missense probably benign 0.02
IGL02623:Gm4787 APN 12 81378728 missense probably damaging 1.00
IGL02681:Gm4787 APN 12 81378769 missense possibly damaging 0.88
IGL03257:Gm4787 APN 12 81378052 missense probably damaging 1.00
IGL03410:Gm4787 APN 12 81379174 missense probably damaging 1.00
F5770:Gm4787 UTSW 12 81377567 nonsense probably null
PIT4362001:Gm4787 UTSW 12 81377175 missense probably benign
R0070:Gm4787 UTSW 12 81379066 missense probably damaging 1.00
R0128:Gm4787 UTSW 12 81377747 nonsense probably null
R0220:Gm4787 UTSW 12 81378648 missense probably damaging 0.98
R0304:Gm4787 UTSW 12 81378934 missense probably damaging 1.00
R0513:Gm4787 UTSW 12 81378312 missense probably benign 0.03
R1761:Gm4787 UTSW 12 81377176 missense probably benign 0.02
R1809:Gm4787 UTSW 12 81378529 missense possibly damaging 0.91
R1853:Gm4787 UTSW 12 81378334 missense probably damaging 1.00
R1854:Gm4787 UTSW 12 81378334 missense probably damaging 1.00
R2030:Gm4787 UTSW 12 81378770 missense probably damaging 1.00
R2063:Gm4787 UTSW 12 81378920 missense probably benign 0.39
R2112:Gm4787 UTSW 12 81377833 missense probably damaging 1.00
R2140:Gm4787 UTSW 12 81378562 missense probably benign 0.03
R2151:Gm4787 UTSW 12 81377219 missense probably benign 0.00
R2152:Gm4787 UTSW 12 81377219 missense probably benign 0.00
R2342:Gm4787 UTSW 12 81378758 missense possibly damaging 0.91
R2504:Gm4787 UTSW 12 81379137 missense possibly damaging 0.93
R4038:Gm4787 UTSW 12 81378358 missense probably damaging 1.00
R4604:Gm4787 UTSW 12 81379213 missense probably benign 0.17
R4748:Gm4787 UTSW 12 81378056 missense probably damaging 1.00
R4750:Gm4787 UTSW 12 81378367 missense possibly damaging 0.95
R4928:Gm4787 UTSW 12 81378838 missense probably benign 0.03
R4960:Gm4787 UTSW 12 81379316 missense probably damaging 0.99
R4974:Gm4787 UTSW 12 81377629 missense probably damaging 0.99
R5028:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5029:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5031:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5098:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5099:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5100:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5101:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5135:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5152:Gm4787 UTSW 12 81378677 missense probably benign 0.02
R5180:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5220:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5257:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5258:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5297:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5324:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5325:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5355:Gm4787 UTSW 12 81377465 nonsense probably null
R5364:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5396:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5397:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5398:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5514:Gm4787 UTSW 12 81378328 missense possibly damaging 0.90
R5634:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5666:Gm4787 UTSW 12 81378031 missense probably benign 0.23
R5670:Gm4787 UTSW 12 81378031 missense probably benign 0.23
R5787:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R6354:Gm4787 UTSW 12 81377981 missense probably damaging 1.00
R6932:Gm4787 UTSW 12 81379200 missense probably benign 0.04
R7120:Gm4787 UTSW 12 81378486 missense probably benign 0.00
R7237:Gm4787 UTSW 12 81377668 missense probably damaging 0.99
V7580:Gm4787 UTSW 12 81377567 nonsense probably null
V7581:Gm4787 UTSW 12 81377567 nonsense probably null
V7582:Gm4787 UTSW 12 81377567 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACGCTTGACACCATCACAGTG -3'
(R):5'- TCAGGGCAGCTCTTGTAATAAAGG -3'

Sequencing Primer
(F):5'- CCATCACAGTGGAGCATTCC -3'
(R):5'- CAGCTCTTGTAATAAAGGAGGTTGC -3'
Posted On2016-12-15