Incidental Mutation 'R5789:Dnah3'
ID448212
Institutional Source Beutler Lab
Gene Symbol Dnah3
Ensembl Gene ENSMUSG00000052273
Gene Namedynein, axonemal, heavy chain 3
Synonyms
MMRRC Submission 043383-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.121) question?
Stock #R5789 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location119922671-120095280 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 119943599 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Aspartic acid at position 3530 (A3530D)
Ref Sequence ENSEMBL: ENSMUSP00000042857 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046993] [ENSMUST00000207270] [ENSMUST00000208424] [ENSMUST00000208701] [ENSMUST00000209154] [ENSMUST00000213149]
Predicted Effect possibly damaging
Transcript: ENSMUST00000046993
AA Change: A3530D

PolyPhen 2 Score 0.696 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000042857
Gene: ENSMUSG00000052273
AA Change: A3530D

DomainStartEndE-ValueType
low complexity region 121 133 N/A INTRINSIC
low complexity region 805 820 N/A INTRINSIC
Pfam:DHC_N2 826 1235 3.3e-144 PFAM
AAA 1388 1527 1.59e-1 SMART
low complexity region 1594 1606 N/A INTRINSIC
Blast:AAA 1669 1897 9e-84 BLAST
AAA 2033 2180 1.33e-3 SMART
Pfam:AAA_8 2362 2632 1.5e-63 PFAM
Pfam:MT 2644 2994 7.4e-52 PFAM
Pfam:AAA_9 3015 3240 3.5e-92 PFAM
low complexity region 3338 3349 N/A INTRINSIC
Pfam:Dynein_heavy 3376 4079 4.4e-285 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207270
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207680
Predicted Effect probably benign
Transcript: ENSMUST00000208424
Predicted Effect probably benign
Transcript: ENSMUST00000208701
AA Change: A551D

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
Predicted Effect probably benign
Transcript: ENSMUST00000209154
AA Change: A3519D

PolyPhen 2 Score 0.056 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000213149
Meta Mutation Damage Score 0.102 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 97% (61/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the dynein family, whose members encode large proteins that are constituents of the microtubule-associated motor protein complex. This complex is composed of dynein heavy, intermediate and light chains, which can be axonemal or cytoplasmic. This protein is an axonemal dynein heavy chain. It is involved in producing force for ciliary beating by using energy from ATP hydrolysis. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110043O21Rik T A 4: 35,226,112 probably benign Het
Abcb11 A G 2: 69,245,764 F1200S probably damaging Het
Ahnak A T 19: 9,002,321 D323V probably benign Het
Aloxe3 T C 11: 69,126,439 Y13H probably damaging Het
Aqp1 A G 6: 55,336,761 I91V probably benign Het
Carmil1 A G 13: 24,121,848 S318P probably damaging Het
Cdan1 A G 2: 120,729,535 F383L probably benign Het
Col6a2 T A 10: 76,604,389 E606V probably damaging Het
Col6a5 T C 9: 105,864,608 T2371A possibly damaging Het
Cops3 T C 11: 59,830,280 probably benign Het
Coq7 G T 7: 118,529,706 H35Q possibly damaging Het
Cp T A 3: 19,957,290 F3I probably benign Het
D630003M21Rik C T 2: 158,216,814 E389K possibly damaging Het
Dclre1c A T 2: 3,437,956 Q51L probably damaging Het
Dhx37 A C 5: 125,421,039 I702S possibly damaging Het
Dnajc13 T C 9: 104,214,188 R635G probably damaging Het
Dnhd1 A G 7: 105,705,010 S3066G possibly damaging Het
Doc2b T A 11: 75,786,115 H144L probably damaging Het
Eif2b3 T A 4: 117,028,495 I78N probably damaging Het
Enpp1 A T 10: 24,647,239 H767Q probably benign Het
Fam180a C A 6: 35,313,526 *174L probably null Het
Gabra1 A T 11: 42,182,915 probably benign Het
Gfral C T 9: 76,197,046 R228Q probably benign Het
Gm16551 T A 9: 74,849,253 noncoding transcript Het
Ifi213 C A 1: 173,568,794 probably benign Het
Inpp4a T C 1: 37,372,329 V358A possibly damaging Het
Kmt2a T C 9: 44,819,904 probably benign Het
Mrgprb13 A T 7: 48,312,198 noncoding transcript Het
Narfl T C 17: 25,781,203 C303R probably benign Het
Nckap5 A G 1: 126,027,702 F371S probably damaging Het
Nudcd1 G A 15: 44,388,483 Q428* probably null Het
Pcdhgc5 C A 18: 37,821,506 P611Q probably damaging Het
Plekhb1 A T 7: 100,645,586 Y193* probably null Het
Prrt1 T C 17: 34,631,957 probably null Het
Ptpn12 G A 5: 20,989,015 T753I possibly damaging Het
Samsn1 T C 16: 75,876,448 D180G probably damaging Het
Sh2d2a T A 3: 87,849,513 probably benign Het
Skiv2l2 A T 13: 112,891,285 N680K probably benign Het
Slc12a2 T A 18: 57,912,019 probably null Het
Socs3 T A 11: 117,967,782 Q150L probably benign Het
Supt6 A G 11: 78,233,586 V23A unknown Het
Tcf12 T C 9: 71,885,236 Y119C probably damaging Het
Them5 A G 3: 94,346,601 E210G probably damaging Het
Tmem135 A G 7: 89,196,122 F167S possibly damaging Het
Tmem170 A G 8: 111,866,400 V134A possibly damaging Het
Trbv20 A G 6: 41,188,791 Y50C probably damaging Het
Uroc1 A G 6: 90,344,197 M252V probably damaging Het
Wasf1 G A 10: 40,926,574 R75Q probably damaging Het
Xpnpep3 T A 15: 81,415,864 probably benign Het
Yars C T 4: 129,196,897 T78M probably damaging Het
Zdhhc16 T A 19: 41,938,133 H98Q probably damaging Het
Zfp90 T C 8: 106,423,973 L106P probably benign Het
Zscan22 T G 7: 12,903,926 S82A probably benign Het
Other mutations in Dnah3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00650:Dnah3 APN 7 119938905 missense possibly damaging 0.88
IGL01095:Dnah3 APN 7 119951597 missense probably benign 0.02
IGL01329:Dnah3 APN 7 120022941 missense probably damaging 1.00
IGL01380:Dnah3 APN 7 119926564 missense probably damaging 1.00
IGL01410:Dnah3 APN 7 119967720 missense possibly damaging 0.91
IGL01487:Dnah3 APN 7 119965530 nonsense probably null
IGL01843:Dnah3 APN 7 119943575 missense probably benign 0.12
IGL01929:Dnah3 APN 7 119951651 nonsense probably null
IGL01994:Dnah3 APN 7 119951214 missense possibly damaging 0.58
IGL02115:Dnah3 APN 7 120029054 missense probably damaging 1.00
IGL02273:Dnah3 APN 7 119951271 missense probably damaging 1.00
IGL02299:Dnah3 APN 7 119967579 missense probably benign 0.39
IGL02421:Dnah3 APN 7 119950992 missense possibly damaging 0.87
IGL02514:Dnah3 APN 7 119966247 missense probably damaging 1.00
IGL02596:Dnah3 APN 7 119938914 missense probably benign 0.19
IGL02716:Dnah3 APN 7 119937023 missense probably damaging 0.97
IGL02738:Dnah3 APN 7 119965497 missense probably benign
IGL03404:Dnah3 APN 7 119938977 missense probably damaging 1.00
R0011:Dnah3 UTSW 7 120019701 missense probably damaging 1.00
R0195:Dnah3 UTSW 7 120077775 critical splice donor site probably null
R0241:Dnah3 UTSW 7 119922730 missense probably damaging 1.00
R0241:Dnah3 UTSW 7 119922730 missense probably damaging 1.00
R0312:Dnah3 UTSW 7 120045659 missense probably damaging 1.00
R0316:Dnah3 UTSW 7 119965659 missense possibly damaging 0.94
R0370:Dnah3 UTSW 7 120086720 missense possibly damaging 0.91
R0426:Dnah3 UTSW 7 119943572 missense probably benign 0.11
R0525:Dnah3 UTSW 7 119928754 missense probably damaging 1.00
R0625:Dnah3 UTSW 7 120071887 missense possibly damaging 0.68
R0627:Dnah3 UTSW 7 120020915 missense probably damaging 1.00
R0632:Dnah3 UTSW 7 119967905 missense probably benign 0.11
R0928:Dnah3 UTSW 7 120030051 missense probably damaging 1.00
R0964:Dnah3 UTSW 7 119952739 splice site probably benign
R0972:Dnah3 UTSW 7 120035340 splice site probably null
R1066:Dnah3 UTSW 7 120061009 missense probably damaging 1.00
R1082:Dnah3 UTSW 7 120078445 missense probably damaging 1.00
R1127:Dnah3 UTSW 7 119923030 missense probably damaging 1.00
R1132:Dnah3 UTSW 7 119939004 missense possibly damaging 0.50
R1222:Dnah3 UTSW 7 120090676 missense probably benign 0.28
R1420:Dnah3 UTSW 7 119951979 missense probably damaging 0.99
R1456:Dnah3 UTSW 7 120047630 missense probably damaging 1.00
R1472:Dnah3 UTSW 7 120070958 missense probably benign 0.12
R1617:Dnah3 UTSW 7 120089946 missense probably benign 0.01
R1624:Dnah3 UTSW 7 120019695 missense probably damaging 0.99
R1654:Dnah3 UTSW 7 119926449 missense probably damaging 1.00
R1673:Dnah3 UTSW 7 119971179 nonsense probably null
R1677:Dnah3 UTSW 7 119928740 missense probably damaging 1.00
R1687:Dnah3 UTSW 7 120045786 splice site probably null
R1711:Dnah3 UTSW 7 120078571 missense probably damaging 1.00
R1738:Dnah3 UTSW 7 120035359 missense probably damaging 1.00
R1778:Dnah3 UTSW 7 120078402 missense probably damaging 1.00
R1866:Dnah3 UTSW 7 119928856 splice site probably null
R1883:Dnah3 UTSW 7 120077919 missense probably benign 0.06
R1894:Dnah3 UTSW 7 120086334 missense probably benign 0.05
R1929:Dnah3 UTSW 7 119975129 missense probably benign 0.10
R1988:Dnah3 UTSW 7 119967570 missense possibly damaging 0.92
R1988:Dnah3 UTSW 7 119967959 missense probably damaging 0.99
R2010:Dnah3 UTSW 7 120095177 start codon destroyed probably benign 0.00
R2022:Dnah3 UTSW 7 119951242 missense probably damaging 1.00
R2026:Dnah3 UTSW 7 120039406 missense probably damaging 1.00
R2063:Dnah3 UTSW 7 119951909 missense probably damaging 0.96
R2131:Dnah3 UTSW 7 119967759 missense possibly damaging 0.93
R2152:Dnah3 UTSW 7 119952013 missense probably benign 0.02
R2199:Dnah3 UTSW 7 119951569 missense possibly damaging 0.89
R2271:Dnah3 UTSW 7 119975129 missense probably benign 0.10
R2350:Dnah3 UTSW 7 120045788 splice site probably null
R2567:Dnah3 UTSW 7 119952697 missense possibly damaging 0.83
R2848:Dnah3 UTSW 7 119967938 missense probably benign 0.01
R2902:Dnah3 UTSW 7 119951499 missense possibly damaging 0.61
R2926:Dnah3 UTSW 7 119951115 missense probably damaging 1.00
R2944:Dnah3 UTSW 7 119951110 missense probably damaging 1.00
R3022:Dnah3 UTSW 7 120078481 missense possibly damaging 0.93
R3401:Dnah3 UTSW 7 119967656 missense probably benign 0.00
R3402:Dnah3 UTSW 7 119967656 missense probably benign 0.00
R3403:Dnah3 UTSW 7 119967656 missense probably benign 0.00
R3919:Dnah3 UTSW 7 119951080 missense probably damaging 1.00
R3972:Dnah3 UTSW 7 120086720 missense probably damaging 0.99
R4162:Dnah3 UTSW 7 119922838 missense probably damaging 1.00
R4184:Dnah3 UTSW 7 120083293 missense probably damaging 1.00
R4198:Dnah3 UTSW 7 119922838 missense probably damaging 1.00
R4199:Dnah3 UTSW 7 119922838 missense probably damaging 1.00
R4200:Dnah3 UTSW 7 119922838 missense probably damaging 1.00
R4239:Dnah3 UTSW 7 120029025 nonsense probably null
R4478:Dnah3 UTSW 7 120071863 missense probably benign 0.00
R4579:Dnah3 UTSW 7 120009331 missense probably damaging 1.00
R4600:Dnah3 UTSW 7 120089946 missense probably benign
R4649:Dnah3 UTSW 7 120047698 missense probably damaging 1.00
R4658:Dnah3 UTSW 7 119950651 missense probably damaging 1.00
R4728:Dnah3 UTSW 7 120059366 missense probably damaging 0.99
R4739:Dnah3 UTSW 7 120077946 missense possibly damaging 0.54
R4758:Dnah3 UTSW 7 120079406 missense probably benign 0.00
R4785:Dnah3 UTSW 7 119967824 missense probably benign 0.29
R4789:Dnah3 UTSW 7 120011072 missense probably damaging 1.00
R4930:Dnah3 UTSW 7 119951681 nonsense probably null
R4935:Dnah3 UTSW 7 120016477 nonsense probably null
R4946:Dnah3 UTSW 7 119931560 missense probably damaging 1.00
R4981:Dnah3 UTSW 7 119956201 missense probably benign 0.03
R4984:Dnah3 UTSW 7 119928779 missense probably benign 0.04
R5025:Dnah3 UTSW 7 120071905 missense probably benign 0.02
R5046:Dnah3 UTSW 7 119951580 missense probably damaging 1.00
R5056:Dnah3 UTSW 7 120020946 missense probably damaging 1.00
R5068:Dnah3 UTSW 7 120032790 missense probably benign
R5069:Dnah3 UTSW 7 120032790 missense probably benign
R5154:Dnah3 UTSW 7 119952419 missense probably damaging 1.00
R5208:Dnah3 UTSW 7 120032638 missense probably damaging 1.00
R5323:Dnah3 UTSW 7 120021011 missense probably damaging 1.00
R5330:Dnah3 UTSW 7 119943648 missense probably benign 0.00
R5385:Dnah3 UTSW 7 119924903 missense probably damaging 1.00
R5391:Dnah3 UTSW 7 120090076 missense probably benign 0.02
R5564:Dnah3 UTSW 7 119971466 critical splice donor site probably null
R5594:Dnah3 UTSW 7 119971621 missense possibly damaging 0.89
R5610:Dnah3 UTSW 7 119939065 intron probably null
R5673:Dnah3 UTSW 7 119951589 missense possibly damaging 0.91
R5678:Dnah3 UTSW 7 120077851 missense probably benign 0.00
R5737:Dnah3 UTSW 7 120059198 missense probably benign 0.03
R5766:Dnah3 UTSW 7 119978222 missense probably damaging 1.00
R5769:Dnah3 UTSW 7 120089952 nonsense probably null
R5791:Dnah3 UTSW 7 119931473 missense probably benign 0.00
R5841:Dnah3 UTSW 7 119951021 utr 3 prime probably benign
R5843:Dnah3 UTSW 7 119951021 utr 3 prime probably benign
R5844:Dnah3 UTSW 7 119951021 utr 3 prime probably benign
R5846:Dnah3 UTSW 7 119951021 utr 3 prime probably benign
R5851:Dnah3 UTSW 7 120039362 missense possibly damaging 0.51
R5853:Dnah3 UTSW 7 119938833 missense probably damaging 1.00
R5857:Dnah3 UTSW 7 119951021 utr 3 prime probably benign
R5865:Dnah3 UTSW 7 119975108 missense probably benign 0.00
R5885:Dnah3 UTSW 7 120069704 missense probably benign 0.10
R5898:Dnah3 UTSW 7 120078501 missense probably benign 0.37
R5917:Dnah3 UTSW 7 120016526 missense probably damaging 1.00
R5964:Dnah3 UTSW 7 119922880 missense probably benign 0.00
R5990:Dnah3 UTSW 7 120073541 missense probably benign
R6004:Dnah3 UTSW 7 120086297 missense probably benign 0.10
R6033:Dnah3 UTSW 7 120071647 missense probably benign 0.00
R6033:Dnah3 UTSW 7 120071647 missense probably benign 0.00
R6045:Dnah3 UTSW 7 119967522 missense probably damaging 0.99
R6056:Dnah3 UTSW 7 120030031 missense probably damaging 1.00
R6133:Dnah3 UTSW 7 120086246 missense probably benign 0.10
R6229:Dnah3 UTSW 7 119965488 missense probably benign 0.11
R6237:Dnah3 UTSW 7 120009384 missense probably damaging 1.00
R6333:Dnah3 UTSW 7 120054633 missense probably damaging 1.00
R6408:Dnah3 UTSW 7 119922968 unclassified probably null
R6447:Dnah3 UTSW 7 119923054 missense probably benign 0.12
R6606:Dnah3 UTSW 7 120060956 missense probably benign 0.02
R6666:Dnah3 UTSW 7 120070949 missense probably benign 0.16
R6733:Dnah3 UTSW 7 119922974 missense probably benign 0.22
R6815:Dnah3 UTSW 7 119971727 missense probably benign
R6882:Dnah3 UTSW 7 119971184 missense possibly damaging 0.95
R6934:Dnah3 UTSW 7 120054601 critical splice donor site probably null
R6966:Dnah3 UTSW 7 120032754 missense probably damaging 1.00
R7025:Dnah3 UTSW 7 120030010 missense possibly damaging 0.90
R7207:Dnah3 UTSW 7 119971089 missense probably damaging 1.00
R7214:Dnah3 UTSW 7 119922742 missense probably damaging 1.00
R7222:Dnah3 UTSW 7 120071523 missense probably benign 0.00
R7235:Dnah3 UTSW 7 120032670 missense probably damaging 1.00
R7241:Dnah3 UTSW 7 119943633 missense probably benign 0.03
R7313:Dnah3 UTSW 7 119981344 missense probably benign 0.39
R7342:Dnah3 UTSW 7 120029985 missense probably damaging 1.00
R7368:Dnah3 UTSW 7 120029016 missense probably benign
R7375:Dnah3 UTSW 7 119951677 missense probably damaging 1.00
R7395:Dnah3 UTSW 7 119966251 missense
R7395:Dnah3 UTSW 7 120060960 missense probably benign 0.00
Z1088:Dnah3 UTSW 7 120010873 missense probably null 1.00
Z1088:Dnah3 UTSW 7 120086297 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGCTGAAGACCTTGACCTGG -3'
(R):5'- TTTAGCAGTTCACAGAGGCTG -3'

Sequencing Primer
(F):5'- ACCTTGACCTGGTCCCAG -3'
(R):5'- AATCCAAAATGTCAATGTGTCTCTCC -3'
Posted On2016-12-15