Incidental Mutation 'R5789:Aloxe3'
ID448225
Institutional Source Beutler Lab
Gene Symbol Aloxe3
Ensembl Gene ENSMUSG00000020892
Gene Namearachidonate lipoxygenase 3
Synonymse-LOX-3
MMRRC Submission 043383-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5789 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location69125896-69149115 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 69126439 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 13 (Y13H)
Ref Sequence ENSEMBL: ENSMUSP00000134814 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021268] [ENSMUST00000024543] [ENSMUST00000175661] [ENSMUST00000180487]
Predicted Effect probably damaging
Transcript: ENSMUST00000021268
AA Change: Y13H

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000021268
Gene: ENSMUSG00000020892
AA Change: Y13H

DomainStartEndE-ValueType
LH2 2 116 1.93e-20 SMART
Pfam:Lipoxygenase 249 697 3.4e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000024543
SMART Domains Protein: ENSMUSP00000024543
Gene: ENSMUSG00000023781

DomainStartEndE-ValueType
HLH 18 75 2.01e-5 SMART
low complexity region 137 152 N/A INTRINSIC
low complexity region 188 203 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155324
Predicted Effect probably damaging
Transcript: ENSMUST00000175661
AA Change: Y13H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000134814
Gene: ENSMUSG00000020892
AA Change: Y13H

DomainStartEndE-ValueType
LH2 2 116 1.93e-20 SMART
Pfam:Lipoxygenase 245 377 7.6e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000180487
SMART Domains Protein: ENSMUSP00000137894
Gene: ENSMUSG00000097386

DomainStartEndE-ValueType
low complexity region 31 40 N/A INTRINSIC
transmembrane domain 87 109 N/A INTRINSIC
Meta Mutation Damage Score 0.09 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 97% (61/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the lipoxygenase family, which are catabolized by arachidonic acid-derived compounds. The encoded enzyme is a hydroperoxide isomerase that synthesizes a unique type of epoxy alcohol (8R-hydroxy-11R,12R-epoxyeicosa-5Z,9E,14Z-trienoic acid) from 12R-hydroperoxyeicosatetraenoic acid (12R-HPETE). This epoxy alcohol can activate the the nuclear receptor peroxisome proliferator-activated receptor alpha (PPARalpha), which is implicated in epidermal differentiation. Loss of function of the enzyme encoded by this gene results in ichthyosis, implicating the function of this gene in the differentiation of human skin. This gene is part of a cluster of lipoxygenase genes on 17p13.1. Mutations in this gene result in nonbullous congenital ichthyosiform erythroderma (NCIE). Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete neonatal lethality, imapired skin barrier function, dehydration, tightly packed stratum corneum, impaired stratum corneum desquamation and reduced levels of ester-bound ceramide in the epidermis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110043O21Rik T A 4: 35,226,112 probably benign Het
Abcb11 A G 2: 69,245,764 F1200S probably damaging Het
Ahnak A T 19: 9,002,321 D323V probably benign Het
Aqp1 A G 6: 55,336,761 I91V probably benign Het
Carmil1 A G 13: 24,121,848 S318P probably damaging Het
Cdan1 A G 2: 120,729,535 F383L probably benign Het
Col6a2 T A 10: 76,604,389 E606V probably damaging Het
Col6a5 T C 9: 105,864,608 T2371A possibly damaging Het
Cops3 T C 11: 59,830,280 probably benign Het
Coq7 G T 7: 118,529,706 H35Q possibly damaging Het
Cp T A 3: 19,957,290 F3I probably benign Het
D630003M21Rik C T 2: 158,216,814 E389K possibly damaging Het
Dclre1c A T 2: 3,437,956 Q51L probably damaging Het
Dhx37 A C 5: 125,421,039 I702S possibly damaging Het
Dnah3 G T 7: 119,943,599 A3530D possibly damaging Het
Dnajc13 T C 9: 104,214,188 R635G probably damaging Het
Dnhd1 A G 7: 105,705,010 S3066G possibly damaging Het
Doc2b T A 11: 75,786,115 H144L probably damaging Het
Eif2b3 T A 4: 117,028,495 I78N probably damaging Het
Enpp1 A T 10: 24,647,239 H767Q probably benign Het
Fam180a C A 6: 35,313,526 *174L probably null Het
Gabra1 A T 11: 42,182,915 probably benign Het
Gfral C T 9: 76,197,046 R228Q probably benign Het
Gm16551 T A 9: 74,849,253 noncoding transcript Het
Ifi213 C A 1: 173,568,794 probably benign Het
Inpp4a T C 1: 37,372,329 V358A possibly damaging Het
Kmt2a T C 9: 44,819,904 probably benign Het
Mrgprb13 A T 7: 48,312,198 noncoding transcript Het
Narfl T C 17: 25,781,203 C303R probably benign Het
Nckap5 A G 1: 126,027,702 F371S probably damaging Het
Nudcd1 G A 15: 44,388,483 Q428* probably null Het
Pcdhgc5 C A 18: 37,821,506 P611Q probably damaging Het
Plekhb1 A T 7: 100,645,586 Y193* probably null Het
Prrt1 T C 17: 34,631,957 probably null Het
Ptpn12 G A 5: 20,989,015 T753I possibly damaging Het
Samsn1 T C 16: 75,876,448 D180G probably damaging Het
Sh2d2a T A 3: 87,849,513 probably benign Het
Skiv2l2 A T 13: 112,891,285 N680K probably benign Het
Slc12a2 T A 18: 57,912,019 probably null Het
Socs3 T A 11: 117,967,782 Q150L probably benign Het
Supt6 A G 11: 78,233,586 V23A unknown Het
Tcf12 T C 9: 71,885,236 Y119C probably damaging Het
Them5 A G 3: 94,346,601 E210G probably damaging Het
Tmem135 A G 7: 89,196,122 F167S possibly damaging Het
Tmem170 A G 8: 111,866,400 V134A possibly damaging Het
Trbv20 A G 6: 41,188,791 Y50C probably damaging Het
Uroc1 A G 6: 90,344,197 M252V probably damaging Het
Wasf1 G A 10: 40,926,574 R75Q probably damaging Het
Xpnpep3 T A 15: 81,415,864 probably benign Het
Yars C T 4: 129,196,897 T78M probably damaging Het
Zdhhc16 T A 19: 41,938,133 H98Q probably damaging Het
Zfp90 T C 8: 106,423,973 L106P probably benign Het
Zscan22 T G 7: 12,903,926 S82A probably benign Het
Other mutations in Aloxe3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01621:Aloxe3 APN 11 69130013 missense probably benign 0.41
IGL01925:Aloxe3 APN 11 69128633 missense probably damaging 1.00
IGL01947:Aloxe3 APN 11 69143021 splice site probably benign
IGL02421:Aloxe3 APN 11 69130046 missense possibly damaging 0.87
IGL03206:Aloxe3 APN 11 69129646 missense possibly damaging 0.74
IGL03054:Aloxe3 UTSW 11 69129607 missense possibly damaging 0.78
R1613:Aloxe3 UTSW 11 69130046 missense possibly damaging 0.87
R1757:Aloxe3 UTSW 11 69135949 missense possibly damaging 0.72
R1839:Aloxe3 UTSW 11 69130085 missense probably damaging 1.00
R2182:Aloxe3 UTSW 11 69129600 missense possibly damaging 0.93
R2912:Aloxe3 UTSW 11 69130040 missense probably damaging 1.00
R2919:Aloxe3 UTSW 11 69142923 missense probably damaging 0.99
R2920:Aloxe3 UTSW 11 69142923 missense probably damaging 0.99
R4731:Aloxe3 UTSW 11 69128654 missense probably null 0.59
R5245:Aloxe3 UTSW 11 69129676 missense probably benign 0.00
R5459:Aloxe3 UTSW 11 69132828 missense possibly damaging 0.66
R5493:Aloxe3 UTSW 11 69128617 nonsense probably null
R5725:Aloxe3 UTSW 11 69128654 missense probably null 0.59
R5755:Aloxe3 UTSW 11 69132749 missense probably benign 0.04
X0019:Aloxe3 UTSW 11 69148735 missense probably damaging 1.00
X0020:Aloxe3 UTSW 11 69133027 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- ACGTCCTAGAGCTGGATCCTTC -3'
(R):5'- ATCGTCTCCCAAAAGTCAGGG -3'

Sequencing Primer
(F):5'- TAGAGCTGGATCCTTCCTCAGG -3'
(R):5'- GTTCAGCAGGACTTGACGAATCC -3'
Posted On2016-12-15