Incidental Mutation 'R5790:Dnajc1'
ID448246
Institutional Source Beutler Lab
Gene Symbol Dnajc1
Ensembl Gene ENSMUSG00000026740
Gene NameDnaJ heat shock protein family (Hsp40) member C1
Synonyms4733401K02Rik, MTJ1, Dnajl1, D230036H06Rik, ERdj1
MMRRC Submission 043384-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R5790 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location18195654-18392830 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 18307087 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000028072] [ENSMUST00000091418] [ENSMUST00000166495]
Predicted Effect probably benign
Transcript: ENSMUST00000028072
SMART Domains Protein: ENSMUSP00000028072
Gene: ENSMUSG00000026740

DomainStartEndE-ValueType
signal peptide 1 43 N/A INTRINSIC
DnaJ 60 104 5.4e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000091418
SMART Domains Protein: ENSMUSP00000088980
Gene: ENSMUSG00000026740

DomainStartEndE-ValueType
signal peptide 1 43 N/A INTRINSIC
DnaJ 60 117 5.73e-23 SMART
transmembrane domain 149 171 N/A INTRINSIC
low complexity region 177 194 N/A INTRINSIC
low complexity region 269 281 N/A INTRINSIC
SANT 324 375 2.06e-6 SMART
low complexity region 416 434 N/A INTRINSIC
low complexity region 438 451 N/A INTRINSIC
SANT 491 543 3.56e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153055
Predicted Effect probably benign
Transcript: ENSMUST00000163130
SMART Domains Protein: ENSMUSP00000129176
Gene: ENSMUSG00000026740

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
DnaJ 34 78 5.4e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164606
Predicted Effect probably benign
Transcript: ENSMUST00000164835
Predicted Effect probably benign
Transcript: ENSMUST00000166495
SMART Domains Protein: ENSMUSP00000126321
Gene: ENSMUSG00000026740

DomainStartEndE-ValueType
signal peptide 1 43 N/A INTRINSIC
DnaJ 60 117 5.73e-23 SMART
transmembrane domain 149 171 N/A INTRINSIC
low complexity region 177 194 N/A INTRINSIC
low complexity region 269 281 N/A INTRINSIC
SANT 324 375 2.06e-6 SMART
low complexity region 416 434 N/A INTRINSIC
low complexity region 438 451 N/A INTRINSIC
SANT 491 543 3.56e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168723
SMART Domains Protein: ENSMUSP00000126716
Gene: ENSMUSG00000026740

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 74 86 N/A INTRINSIC
SANT 129 180 2.06e-6 SMART
low complexity region 221 239 N/A INTRINSIC
low complexity region 243 256 N/A INTRINSIC
SANT 296 348 3.56e-10 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 99% (73/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane protein encoded by this gene is a DNAJ-like heat shock protein that binds the molecular chaperone BiP. In addition, the encoded protein contains two SANT domains that have been shown to bind serpin alpha1-antichymotrypsin and inter-alpha trypsin inhibitor heavy chain 4. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl5 A T 5: 30,894,358 R633* probably null Het
Ahnak T C 19: 9,015,248 V4632A probably damaging Het
Asap1 T A 15: 64,094,265 D997V probably damaging Het
Atad2 T C 15: 58,126,594 Y162C probably damaging Het
Atp2b2 G T 6: 113,759,309 S936R probably damaging Het
Bcl11a T A 11: 24,163,650 L331Q probably damaging Het
C6 T A 15: 4,763,486 F358I probably damaging Het
Capn15 C T 17: 25,964,547 S386N probably benign Het
Ccdc66 G A 14: 27,500,447 T113I possibly damaging Het
Cd200 G T 16: 45,397,258 H23Q possibly damaging Het
Cdh17 A G 4: 11,814,945 probably null Het
Ces2b C T 8: 104,833,936 P128S probably damaging Het
Ces3b A T 8: 105,092,638 Q442L probably damaging Het
Chil4 T C 3: 106,202,578 H373R probably benign Het
Ciapin1 C A 8: 94,825,183 probably benign Het
Cnot10 A C 9: 114,625,917 probably null Het
Cpq A G 15: 33,249,997 K167E probably damaging Het
Dennd4b T A 3: 90,277,450 D1118E probably damaging Het
Dnah8 T A 17: 30,875,004 C4691S probably damaging Het
Dnhd1 G A 7: 105,655,774 R341H probably damaging Het
Dock10 G T 1: 80,505,170 T2145K probably benign Het
Eif3b T C 5: 140,442,131 V736A probably benign Het
Eno1 G T 4: 150,245,253 V195L probably benign Het
Ewsr1 C T 11: 5,082,263 probably benign Het
Fbn2 T C 18: 58,076,696 T1038A probably benign Het
Gabrb1 T C 5: 72,136,484 I367T possibly damaging Het
Gigyf1 C T 5: 137,524,255 probably benign Het
Glp2r T A 11: 67,764,799 Y39F probably damaging Het
Gm10036 T A 18: 15,833,186 Y131* probably null Het
Gm38706 T C 6: 130,484,998 noncoding transcript Het
Gna15 G A 10: 81,509,384 R216C probably damaging Het
Grin3a A G 4: 49,792,717 F339L probably damaging Het
Grk3 T G 5: 112,966,976 K126T possibly damaging Het
Hspa1l T C 17: 34,977,240 V85A probably benign Het
Iqsec1 A T 6: 90,689,880 L525* probably null Het
Irx3 T C 8: 91,799,676 T467A probably benign Het
Itga2 G A 13: 114,868,206 T530I probably benign Het
Lonp2 T C 8: 86,631,490 V113A probably benign Het
Msx3 C T 7: 140,048,953 R16H possibly damaging Het
Nek3 C A 8: 22,131,297 Q405H probably damaging Het
Nek3 T A 8: 22,131,298 Q403L probably damaging Het
Olfr11 T C 13: 21,638,876 T216A probably benign Het
Olfr798 A G 10: 129,625,888 Y58H probably damaging Het
P4ha1 A G 10: 59,354,362 N367S probably benign Het
Padi6 C A 4: 140,732,258 G429C probably damaging Het
Pidd1 T C 7: 141,441,392 probably benign Het
Plekhg5 T C 4: 152,113,935 V847A probably benign Het
Polr3e A G 7: 120,927,967 D56G probably damaging Het
Pomt2 T G 12: 87,127,378 N347T probably damaging Het
Ppp1r9a T C 6: 5,134,363 probably benign Het
Rbm33 A T 5: 28,339,298 D184V probably damaging Het
Rims2 A T 15: 39,681,045 T1431S probably damaging Het
Saal1 T C 7: 46,701,928 D208G probably damaging Het
Sis T C 3: 72,928,174 I952V probably benign Het
Slc30a1 T A 1: 191,908,885 D214E probably benign Het
Slc30a8 T C 15: 52,333,647 V318A possibly damaging Het
Smarca2 A G 19: 26,676,724 T770A probably damaging Het
Sptbn4 T A 7: 27,366,428 H2031L probably damaging Het
Ssbp1 A G 6: 40,480,870 S141G probably benign Het
Tgm4 A G 9: 123,061,743 E45G probably damaging Het
Thra T A 11: 98,762,951 S203T probably benign Het
Tle2 T C 10: 81,590,315 Y763H probably damaging Het
Tmem141 T A 2: 25,621,075 I102L probably benign Het
Tmem63c C T 12: 87,057,636 T77I probably benign Het
Tspo2 C A 17: 48,449,019 probably null Het
Ttc19 T A 11: 62,281,514 M1K probably null Het
Ucp1 A G 8: 83,297,891 N282D possibly damaging Het
Vmn1r33 A T 6: 66,612,214 F119I probably benign Het
Vmn2r24 A T 6: 123,815,540 M609L probably benign Het
Vwc2l A T 1: 70,750,983 H146L probably damaging Het
Other mutations in Dnajc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00491:Dnajc1 APN 2 18308902 missense possibly damaging 0.80
IGL01301:Dnajc1 APN 2 18308834 missense probably damaging 0.99
IGL02080:Dnajc1 APN 2 18316348 intron probably benign
IGL03058:Dnajc1 APN 2 18217321 missense possibly damaging 0.90
ANU18:Dnajc1 UTSW 2 18308834 missense probably damaging 0.99
R0537:Dnajc1 UTSW 2 18307956 missense possibly damaging 0.63
R0630:Dnajc1 UTSW 2 18231801 missense probably damaging 1.00
R1187:Dnajc1 UTSW 2 18284709 missense probably benign 0.01
R1511:Dnajc1 UTSW 2 18222727 missense possibly damaging 0.88
R1844:Dnajc1 UTSW 2 18294027 nonsense probably null
R1848:Dnajc1 UTSW 2 18219713 missense probably damaging 1.00
R2174:Dnajc1 UTSW 2 18307951 missense probably damaging 0.99
R2199:Dnajc1 UTSW 2 18308899 missense probably damaging 1.00
R2211:Dnajc1 UTSW 2 18392475 missense probably damaging 0.99
R2471:Dnajc1 UTSW 2 18219816 missense possibly damaging 0.75
R4758:Dnajc1 UTSW 2 18308946 nonsense probably null
R5802:Dnajc1 UTSW 2 18284739 missense probably benign 0.41
R5950:Dnajc1 UTSW 2 18306941 intron probably benign
R6049:Dnajc1 UTSW 2 18231700 splice site probably null
R6770:Dnajc1 UTSW 2 18217271 unclassified probably benign
R7242:Dnajc1 UTSW 2 18293972 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- ATTGACATCCAATCAACAGACATGG -3'
(R):5'- TTGAGCAGGTTCACCTCCAG -3'

Sequencing Primer
(F):5'- CAGACATGGTAATAAATTTTTGGACG -3'
(R):5'- AGCTCCTCCTCTGCAATTGG -3'
Posted On2016-12-15