Incidental Mutation 'R5790:Plekhg5'
ID448255
Institutional Source Beutler Lab
Gene Symbol Plekhg5
Ensembl Gene ENSMUSG00000039713
Gene Namepleckstrin homology domain containing, family G (with RhoGef domain) member 5
Synonyms
MMRRC Submission 043384-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.150) question?
Stock #R5790 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location152072498-152115400 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 152113935 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 847 (V847A)
Ref Sequence ENSEMBL: ENSMUSP00000112707 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025706] [ENSMUST00000035275] [ENSMUST00000084115] [ENSMUST00000105661] [ENSMUST00000105662] [ENSMUST00000118648]
Predicted Effect probably benign
Transcript: ENSMUST00000025706
SMART Domains Protein: ENSMUSP00000025706
Gene: ENSMUSG00000024793

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
TNFR 38 75 4.12e0 SMART
TNFR 78 120 3.78e-5 SMART
transmembrane domain 196 218 N/A INTRINSIC
DEATH 315 407 6.04e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000035275
SMART Domains Protein: ENSMUSP00000047823
Gene: ENSMUSG00000024793

DomainStartEndE-ValueType
signal peptide 1 43 N/A INTRINSIC
TNFR 51 88 4.12e0 SMART
TNFR 91 133 3.78e-5 SMART
transmembrane domain 172 194 N/A INTRINSIC
DEATH 291 383 6.04e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000084115
AA Change: V860A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000081132
Gene: ENSMUSG00000039713
AA Change: V860A

DomainStartEndE-ValueType
low complexity region 314 334 N/A INTRINSIC
low complexity region 369 380 N/A INTRINSIC
RhoGEF 410 597 5.21e-53 SMART
PH 655 756 7.35e-12 SMART
low complexity region 778 790 N/A INTRINSIC
low complexity region 895 934 N/A INTRINSIC
low complexity region 1060 1069 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105661
AA Change: V860A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000101286
Gene: ENSMUSG00000039713
AA Change: V860A

DomainStartEndE-ValueType
low complexity region 314 334 N/A INTRINSIC
low complexity region 369 380 N/A INTRINSIC
RhoGEF 410 597 5.21e-53 SMART
PH 655 756 7.35e-12 SMART
low complexity region 778 790 N/A INTRINSIC
low complexity region 895 934 N/A INTRINSIC
low complexity region 1060 1069 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105662
AA Change: V828A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000101287
Gene: ENSMUSG00000039713
AA Change: V828A

DomainStartEndE-ValueType
low complexity region 282 302 N/A INTRINSIC
low complexity region 337 348 N/A INTRINSIC
RhoGEF 378 565 5.21e-53 SMART
PH 623 724 7.35e-12 SMART
low complexity region 746 758 N/A INTRINSIC
low complexity region 863 902 N/A INTRINSIC
low complexity region 1028 1037 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118648
AA Change: V847A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000112707
Gene: ENSMUSG00000039713
AA Change: V847A

DomainStartEndE-ValueType
low complexity region 301 321 N/A INTRINSIC
low complexity region 356 367 N/A INTRINSIC
RhoGEF 397 584 5.21e-53 SMART
PH 642 743 7.35e-12 SMART
low complexity region 765 777 N/A INTRINSIC
low complexity region 882 921 N/A INTRINSIC
low complexity region 1047 1056 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127111
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140085
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153619
Meta Mutation Damage Score 0.1184 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 99% (73/74)
MGI Phenotype FUNCTION: This gene encodes a protein belonging to the Rho guanine exchange factor (GEF) family of proteins, which activate GTPases by replacing GDP with GTP. This family member is a RhoA GEF that plays a role in endothelial cell migration and tube formation. It is required for angiogenesis and may function in neuronal cell differentiation. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Oct 2013]
PHENOTYPE: Mice homozygous for a knock-out allele display angiogenic defects that affect multiple organs, including sparser coronary and kidney arterial systems that appear to deficient in small diameter vessels while the major coronary and kidney arteries remain intact. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl5 A T 5: 30,894,358 R633* probably null Het
Ahnak T C 19: 9,015,248 V4632A probably damaging Het
Asap1 T A 15: 64,094,265 D997V probably damaging Het
Atad2 T C 15: 58,126,594 Y162C probably damaging Het
Atp2b2 G T 6: 113,759,309 S936R probably damaging Het
Bcl11a T A 11: 24,163,650 L331Q probably damaging Het
C6 T A 15: 4,763,486 F358I probably damaging Het
Capn15 C T 17: 25,964,547 S386N probably benign Het
Ccdc66 G A 14: 27,500,447 T113I possibly damaging Het
Cd200 G T 16: 45,397,258 H23Q possibly damaging Het
Cdh17 A G 4: 11,814,945 probably null Het
Ces2b C T 8: 104,833,936 P128S probably damaging Het
Ces3b A T 8: 105,092,638 Q442L probably damaging Het
Chil4 T C 3: 106,202,578 H373R probably benign Het
Ciapin1 C A 8: 94,825,183 probably benign Het
Cnot10 A C 9: 114,625,917 probably null Het
Cpq A G 15: 33,249,997 K167E probably damaging Het
Dennd4b T A 3: 90,277,450 D1118E probably damaging Het
Dnah8 T A 17: 30,875,004 C4691S probably damaging Het
Dnajc1 A G 2: 18,307,087 probably benign Het
Dnhd1 G A 7: 105,655,774 R341H probably damaging Het
Dock10 G T 1: 80,505,170 T2145K probably benign Het
Eif3b T C 5: 140,442,131 V736A probably benign Het
Eno1 G T 4: 150,245,253 V195L probably benign Het
Ewsr1 C T 11: 5,082,263 probably benign Het
Fbn2 T C 18: 58,076,696 T1038A probably benign Het
Gabrb1 T C 5: 72,136,484 I367T possibly damaging Het
Gigyf1 C T 5: 137,524,255 probably benign Het
Glp2r T A 11: 67,764,799 Y39F probably damaging Het
Gm10036 T A 18: 15,833,186 Y131* probably null Het
Gm38706 T C 6: 130,484,998 noncoding transcript Het
Gna15 G A 10: 81,509,384 R216C probably damaging Het
Grin3a A G 4: 49,792,717 F339L probably damaging Het
Grk3 T G 5: 112,966,976 K126T possibly damaging Het
Hspa1l T C 17: 34,977,240 V85A probably benign Het
Iqsec1 A T 6: 90,689,880 L525* probably null Het
Irx3 T C 8: 91,799,676 T467A probably benign Het
Itga2 G A 13: 114,868,206 T530I probably benign Het
Lonp2 T C 8: 86,631,490 V113A probably benign Het
Msx3 C T 7: 140,048,953 R16H possibly damaging Het
Nek3 C A 8: 22,131,297 Q405H probably damaging Het
Nek3 T A 8: 22,131,298 Q403L probably damaging Het
Olfr11 T C 13: 21,638,876 T216A probably benign Het
Olfr798 A G 10: 129,625,888 Y58H probably damaging Het
P4ha1 A G 10: 59,354,362 N367S probably benign Het
Padi6 C A 4: 140,732,258 G429C probably damaging Het
Pidd1 T C 7: 141,441,392 probably benign Het
Polr3e A G 7: 120,927,967 D56G probably damaging Het
Pomt2 T G 12: 87,127,378 N347T probably damaging Het
Ppp1r9a T C 6: 5,134,363 probably benign Het
Rbm33 A T 5: 28,339,298 D184V probably damaging Het
Rims2 A T 15: 39,681,045 T1431S probably damaging Het
Saal1 T C 7: 46,701,928 D208G probably damaging Het
Sis T C 3: 72,928,174 I952V probably benign Het
Slc30a1 T A 1: 191,908,885 D214E probably benign Het
Slc30a8 T C 15: 52,333,647 V318A possibly damaging Het
Smarca2 A G 19: 26,676,724 T770A probably damaging Het
Sptbn4 T A 7: 27,366,428 H2031L probably damaging Het
Ssbp1 A G 6: 40,480,870 S141G probably benign Het
Tgm4 A G 9: 123,061,743 E45G probably damaging Het
Thra T A 11: 98,762,951 S203T probably benign Het
Tle2 T C 10: 81,590,315 Y763H probably damaging Het
Tmem141 T A 2: 25,621,075 I102L probably benign Het
Tmem63c C T 12: 87,057,636 T77I probably benign Het
Tspo2 C A 17: 48,449,019 probably null Het
Ttc19 T A 11: 62,281,514 M1K probably null Het
Ucp1 A G 8: 83,297,891 N282D possibly damaging Het
Vmn1r33 A T 6: 66,612,214 F119I probably benign Het
Vmn2r24 A T 6: 123,815,540 M609L probably benign Het
Vwc2l A T 1: 70,750,983 H146L probably damaging Het
Other mutations in Plekhg5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Plekhg5 APN 4 152102041 splice site probably null
IGL01025:Plekhg5 APN 4 152108526 missense probably damaging 1.00
IGL01062:Plekhg5 APN 4 152108496 missense probably damaging 1.00
IGL01138:Plekhg5 APN 4 152106978 missense probably damaging 1.00
IGL01301:Plekhg5 APN 4 152112553 missense probably benign
IGL02372:Plekhg5 APN 4 152102080 missense probably damaging 0.96
IGL02701:Plekhg5 APN 4 152103022 missense probably damaging 1.00
ANU18:Plekhg5 UTSW 4 152112553 missense probably benign
R0005:Plekhg5 UTSW 4 152112651 small deletion probably benign
R0012:Plekhg5 UTSW 4 152104750 missense probably benign 0.20
R0050:Plekhg5 UTSW 4 152108088 critical splice donor site probably null
R0233:Plekhg5 UTSW 4 152112219 missense probably damaging 1.00
R0233:Plekhg5 UTSW 4 152112219 missense probably damaging 1.00
R0234:Plekhg5 UTSW 4 152112219 missense probably damaging 1.00
R0346:Plekhg5 UTSW 4 152114253 missense probably benign 0.08
R0555:Plekhg5 UTSW 4 152107469 nonsense probably null
R0631:Plekhg5 UTSW 4 152112419 missense possibly damaging 0.89
R0639:Plekhg5 UTSW 4 152114120 missense probably benign 0.19
R1372:Plekhg5 UTSW 4 152104731 missense probably damaging 0.99
R1563:Plekhg5 UTSW 4 152096809 missense probably benign 0.33
R2870:Plekhg5 UTSW 4 152107503 missense probably benign 0.01
R2870:Plekhg5 UTSW 4 152107503 missense probably benign 0.01
R2871:Plekhg5 UTSW 4 152107503 missense probably benign 0.01
R2871:Plekhg5 UTSW 4 152107503 missense probably benign 0.01
R2872:Plekhg5 UTSW 4 152107503 missense probably benign 0.01
R2872:Plekhg5 UTSW 4 152107503 missense probably benign 0.01
R2873:Plekhg5 UTSW 4 152107503 missense probably benign 0.01
R3104:Plekhg5 UTSW 4 152112178 missense probably damaging 1.00
R3106:Plekhg5 UTSW 4 152112178 missense probably damaging 1.00
R3408:Plekhg5 UTSW 4 152108292 missense probably damaging 1.00
R4289:Plekhg5 UTSW 4 152112427 missense probably benign 0.05
R5157:Plekhg5 UTSW 4 152107865 splice site probably benign
R5643:Plekhg5 UTSW 4 152104340 missense probably benign 0.14
R5644:Plekhg5 UTSW 4 152104340 missense probably benign 0.14
R6770:Plekhg5 UTSW 4 152103079 missense probably benign
R7027:Plekhg5 UTSW 4 152113974 missense probably benign 0.01
R7039:Plekhg5 UTSW 4 152107785 missense possibly damaging 0.90
R7092:Plekhg5 UTSW 4 152114508 missense probably damaging 1.00
R7309:Plekhg5 UTSW 4 152112528 missense possibly damaging 0.50
R7319:Plekhg5 UTSW 4 152108428 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- AGATAATCTGGCTTTCTGACTCTC -3'
(R):5'- GATTTGGACTTGAGCAGGCG -3'

Sequencing Primer
(F):5'- AATCTGGCTTTCTGACTCTCTTCTG -3'
(R):5'- CAGCTGGACAGGAGTGC -3'
Posted On2016-12-15